Incidental Mutation 'R1374:Mlph'
ID157427
Institutional Source Beutler Lab
Gene Symbol Mlph
Ensembl Gene ENSMUSG00000026303
Gene Namemelanophilin
Synonymsl1Rk3, l(1)-3Rk, D1Wsu84e, Slac-2a
MMRRC Submission 039438-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1374 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90915085-90951142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90941703 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 476 (S476T)
Ref Sequence ENSEMBL: ENSMUSP00000027528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027528]
Predicted Effect probably damaging
Transcript: ENSMUST00000027528
AA Change: S476T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027528
Gene: ENSMUSG00000026303
AA Change: S476T

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2e-51 PFAM
low complexity region 147 160 N/A INTRINSIC
PDB:4KP3|F 170 208 1e-18 PDB
low complexity region 379 406 N/A INTRINSIC
Pfam:Rab_eff_C 437 501 1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136220
Meta Mutation Damage Score 0.1020 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 90.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the exophilin subfamily of Rab effector proteins. The protein forms a ternary complex with the small Ras-related GTPase Rab27A in its GTP-bound form and the motor protein myosin Va. A similar protein complex in mouse functions to tether pigment-producing organelles called melanosomes to the actin cytoskeleton in melanocytes, and is required for visible pigmentation in the hair and skin. A mutation in this gene results in Griscelli syndrome type 3, which is characterized by a silver-gray hair color and abnormal pigment distribution in the hair shaft. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous targeted null mutants affect viability and body size, and result in abnormal lungs, kidneys, immune system, hematopoiesis, myelopoiesis, and anomalies in cerebellar foliation and neuronal cell layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap5z1 G A 5: 142,470,458 R344H probably damaging Het
C77080 A G 4: 129,222,289 S849P possibly damaging Het
Ccdc38 C T 10: 93,582,434 probably benign Het
Cd47 T C 16: 49,894,180 L184P probably damaging Het
Cps1 T C 1: 67,230,281 S1480P probably damaging Het
Cyp2a4 A G 7: 26,312,923 D377G probably damaging Het
Ddb1 G A 19: 10,608,318 G132D probably damaging Het
Dlgap2 T C 8: 14,831,228 probably benign Het
Epg5 A G 18: 77,981,326 D1132G probably benign Het
Fam184b T C 5: 45,555,143 E511G probably benign Het
Fbn1 T A 2: 125,346,434 D1495V probably damaging Het
Gpatch1 A T 7: 35,291,762 L619Q probably damaging Het
Inpp4b T G 8: 81,743,816 probably null Het
Kifc1 T C 17: 33,883,875 R192G probably benign Het
Klhl30 C T 1: 91,361,076 T519M probably damaging Het
Klhl8 A C 5: 103,863,183 L516R probably damaging Het
Meikin T A 11: 54,398,444 probably benign Het
Neb T C 2: 52,243,389 Y3379C probably damaging Het
Nfxl1 G A 5: 72,524,145 T681I probably benign Het
Obox1 A T 7: 15,555,501 probably benign Het
Oplah G A 15: 76,306,555 R31C probably damaging Het
Polb T C 8: 22,653,057 probably benign Het
Ppfibp2 A G 7: 107,685,988 probably benign Het
Prr12 A G 7: 45,046,218 S1275P unknown Het
Ptcd3 C A 6: 71,908,653 E30* probably null Het
Ranbp2 T C 10: 58,485,893 probably benign Het
Rapgef2 A G 3: 79,087,968 V791A probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rims1 G A 1: 22,296,948 T1176M probably damaging Het
Ripor2 T C 13: 24,673,112 probably null Het
Sae1 A G 7: 16,378,408 I60T probably damaging Het
Tenm2 T C 11: 36,008,454 T2626A probably benign Het
Trrap A G 5: 144,846,618 Q3419R probably damaging Het
Vill C A 9: 119,061,494 N158K probably benign Het
Zbtb14 A G 17: 69,387,580 N91S probably damaging Het
Zfp248 A G 6: 118,433,373 L25P probably damaging Het
Zmym1 T A 4: 127,049,611 K230I probably damaging Het
Other mutations in Mlph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mlph APN 1 90939390 missense probably damaging 1.00
IGL01779:Mlph APN 1 90942950 missense probably benign
IGL01952:Mlph APN 1 90933471 missense probably benign 0.00
beau UTSW 1 90928122 missense probably damaging 1.00
Golem UTSW 1 unclassified
koala UTSW 1 90933301 unclassified probably benign
R0652:Mlph UTSW 1 90942908 missense possibly damaging 0.89
R1643:Mlph UTSW 1 90941734 missense probably damaging 1.00
R1853:Mlph UTSW 1 90945667 nonsense probably null
R2395:Mlph UTSW 1 90933506 missense probably benign 0.06
R3875:Mlph UTSW 1 90928122 missense probably damaging 1.00
R4632:Mlph UTSW 1 90939386 missense probably damaging 0.99
R4720:Mlph UTSW 1 90941697 missense probably damaging 1.00
R4963:Mlph UTSW 1 90939390 missense probably damaging 1.00
R5588:Mlph UTSW 1 90931599 missense possibly damaging 0.91
R5901:Mlph UTSW 1 90939814 missense probably damaging 1.00
R6063:Mlph UTSW 1 90928160 missense probably damaging 1.00
R6912:Mlph UTSW 1 90945620 missense probably damaging 0.98
R7019:Mlph UTSW 1 90941706 missense probably damaging 1.00
R7336:Mlph UTSW 1 90921983 splice site probably null
R7491:Mlph UTSW 1 90939378 missense possibly damaging 0.87
R7507:Mlph UTSW 1 90927707 start gained probably benign
R7648:Mlph UTSW 1 90933526 splice site probably null
R7899:Mlph UTSW 1 90941763 nonsense probably null
R8792:Mlph UTSW 1 90942960 critical splice donor site probably benign
R8801:Mlph UTSW 1 90942887 missense probably benign 0.00
X0013:Mlph UTSW 1 90928154 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCCTCTAGCTTCAGTGGGAAGAGTAG -3'
(R):5'- GTGGCAAACATGATTAGCAGCATCAAG -3'

Sequencing Primer
(F):5'- agctgtgcctccagAGAG -3'
(R):5'- AGAAAATCAGACCTGTTCCTCTC -3'
Posted On2014-02-18