Incidental Mutation 'R1527:Obox1'
ID166287
Institutional Source Beutler Lab
Gene Symbol Obox1
Ensembl Gene ENSMUSG00000054310
Gene Nameoocyte specific homeobox 1
Synonyms
MMRRC Submission 039567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1527 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location15388948-15556866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15555325 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 55 (V55A)
Ref Sequence ENSEMBL: ENSMUSP00000138010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067288] [ENSMUST00000086122] [ENSMUST00000172463] [ENSMUST00000172881] [ENSMUST00000173245] [ENSMUST00000173443] [ENSMUST00000181001]
Predicted Effect probably damaging
Transcript: ENSMUST00000067288
AA Change: V55A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067691
Gene: ENSMUSG00000054310
AA Change: V55A

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086122
SMART Domains Protein: ENSMUSP00000083291
Gene: ENSMUSG00000066772

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172463
AA Change: V55A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133504
Gene: ENSMUSG00000054310
AA Change: V55A

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172881
AA Change: V55A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134688
Gene: ENSMUSG00000054310
AA Change: V55A

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173245
AA Change: V55A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133496
Gene: ENSMUSG00000054310
AA Change: V55A

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173443
AA Change: V55A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134043
Gene: ENSMUSG00000054310
AA Change: V55A

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181001
AA Change: V55A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138010
Gene: ENSMUSG00000054310
AA Change: V55A

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C A 19: 21,598,269 C130F probably damaging Het
4933402N03Rik T C 7: 131,138,860 D209G probably benign Het
Adam7 A G 14: 68,501,521 V744A probably benign Het
Atr G T 9: 95,870,043 R571I possibly damaging Het
C5ar1 A G 7: 16,248,193 Y301H probably damaging Het
Cacna1d A G 14: 30,107,796 I954T probably damaging Het
Ccdc157 A G 11: 4,151,795 F42S probably damaging Het
Chd2 A T 7: 73,490,614 L622* probably null Het
Csmd3 T C 15: 47,948,087 T1203A probably benign Het
Cxcl17 A G 7: 25,402,211 V67A possibly damaging Het
Ddx4 T C 13: 112,622,239 T263A possibly damaging Het
Eps8l1 A G 7: 4,471,394 D288G probably benign Het
Fam208a T C 14: 27,480,093 probably null Het
Fbxl4 A G 4: 22,386,154 K254E probably benign Het
Glis1 T C 4: 107,567,926 S245P probably damaging Het
Gm11111 T C 5: 98,553,528 probably benign Het
Haus3 A T 5: 34,154,053 H544Q probably benign Het
Hmcn1 A G 1: 150,773,803 V644A probably benign Het
Lmo7 T C 14: 101,876,828 L2P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mga A G 2: 119,916,597 T410A probably damaging Het
Mical3 T C 6: 121,024,779 D584G probably damaging Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Mroh1 A G 15: 76,452,263 D1553G probably benign Het
Myof T C 19: 37,924,619 Y1462C probably damaging Het
Notch4 T C 17: 34,565,744 C144R probably damaging Het
Olfr1241 C T 2: 89,482,532 G201D probably benign Het
Olfr761 T A 17: 37,952,829 H65L possibly damaging Het
Olfr822 T A 10: 130,075,192 S261T probably damaging Het
Pclo T C 5: 14,679,648 probably benign Het
Prr14l C T 5: 32,827,949 V1401I possibly damaging Het
Rad51ap1 T C 6: 126,928,167 probably null Het
Rev3l T A 10: 39,822,822 V1105D probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sgsm2 A T 11: 74,853,848 C848* probably null Het
Slc39a10 A T 1: 46,819,262 V625E probably benign Het
Spry4 C T 18: 38,590,577 M44I probably benign Het
Stat5b A T 11: 100,808,394 probably null Het
Tas2r126 T C 6: 42,435,136 I201T probably benign Het
Tex44 A G 1: 86,427,646 T426A probably benign Het
Tln2 T C 9: 67,272,668 D807G possibly damaging Het
Tlr9 A G 9: 106,223,750 N80S probably benign Het
Trpm7 A C 2: 126,830,162 H579Q probably benign Het
Ufd1 T C 16: 18,814,911 S29P probably damaging Het
Ugt2a3 G T 5: 87,325,598 Q487K probably damaging Het
Wdr66 T C 5: 123,287,345 V789A probably benign Het
Zfyve9 A G 4: 108,695,767 probably null Het
Other mutations in Obox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0420:Obox1 UTSW 7 15556253 missense possibly damaging 0.90
R1374:Obox1 UTSW 7 15555501 splice site probably benign
R1984:Obox1 UTSW 7 15555210 missense probably benign 0.18
R4585:Obox1 UTSW 7 15556227 missense possibly damaging 0.66
R4586:Obox1 UTSW 7 15556227 missense possibly damaging 0.66
R4680:Obox1 UTSW 7 15556164 missense probably damaging 1.00
R4883:Obox1 UTSW 7 15556338 missense probably damaging 1.00
R5742:Obox1 UTSW 7 15555505 missense possibly damaging 0.73
R6331:Obox1 UTSW 7 15555369 missense probably benign 0.00
R6596:Obox1 UTSW 7 15555376 missense probably damaging 1.00
R7442:Obox1 UTSW 7 15555566 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAACACATGCTGAGTAGGTGGG -3'
(R):5'- CTTGAAGCCATTGGGCCAGTTTG -3'

Sequencing Primer
(F):5'- TCAGGTTATCCAGTACAGGAAC -3'
(R):5'- ATTTATCTGACAGTAGCATACAACC -3'
Posted On2014-04-13