Incidental Mutation 'R1322:Sh3bp2'
ID 157709
Institutional Source Beutler Lab
Gene Symbol Sh3bp2
Ensembl Gene ENSMUSG00000054520
Gene Name SH3-domain binding protein 2
Synonyms 3BP2
MMRRC Submission 039388-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1322 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 34683182-34720985 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34712837 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 92 (N92K)
Ref Sequence ENSEMBL: ENSMUSP00000136671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067638] [ENSMUST00000101316] [ENSMUST00000118545] [ENSMUST00000125817] [ENSMUST00000138912] [ENSMUST00000179943]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067638
AA Change: N92K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070890
Gene: ENSMUSG00000054520
AA Change: N92K

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101316
AA Change: N136K

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098874
Gene: ENSMUSG00000054520
AA Change: N136K

DomainStartEndE-ValueType
PH 71 176 1.33e-18 SMART
low complexity region 185 195 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 244 260 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
low complexity region 414 429 N/A INTRINSIC
SH2 497 586 2.04e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118545
AA Change: N148K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112554
Gene: ENSMUSG00000054520
AA Change: N148K

DomainStartEndE-ValueType
PH 83 188 1.33e-18 SMART
low complexity region 197 207 N/A INTRINSIC
low complexity region 226 241 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
SH2 509 598 2.04e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125817
Predicted Effect probably benign
Transcript: ENSMUST00000138912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153750
Predicted Effect probably damaging
Transcript: ENSMUST00000179943
AA Change: N92K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136671
Gene: ENSMUSG00000054520
AA Change: N92K

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202745
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Nullizygous mutations may lead to higher pre-B cell numbers and impaired B cell receptor signaling or thymus-independent type 2 humoral responses. Homozygosity for a knock-in allele causes premature death, enhanced osteoclast differentiation and TNF production, systemic bone loss and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 C T 15: 81,779,394 (GRCm39) S33L probably damaging Het
Col27a1 A C 4: 63,246,803 (GRCm39) probably benign Het
Fam184a G T 10: 53,528,415 (GRCm39) D815E probably damaging Het
Gjb3 G A 4: 127,220,224 (GRCm39) R103W probably damaging Het
Gpr162 G T 6: 124,835,864 (GRCm39) T512K probably damaging Het
Hipk1 A T 3: 103,651,297 (GRCm39) S1155R probably damaging Het
Itih2 A G 2: 10,114,333 (GRCm39) V417A probably damaging Het
Kmt2a A G 9: 44,732,418 (GRCm39) probably benign Het
Mecom G T 3: 30,011,522 (GRCm39) P670Q probably damaging Het
Mgat4d A G 8: 84,092,354 (GRCm39) T247A possibly damaging Het
Nrbp1 T A 5: 31,403,157 (GRCm39) I210N probably damaging Het
Or7g18 T C 9: 18,786,817 (GRCm39) F65L possibly damaging Het
Polr1c T C 17: 46,555,089 (GRCm39) K327R possibly damaging Het
Prpf39 A T 12: 65,089,436 (GRCm39) N58I possibly damaging Het
Sppl3 TGG TG 5: 115,226,352 (GRCm39) probably null Het
Tnc C T 4: 63,932,231 (GRCm39) V728M probably damaging Het
Trgc3 T C 13: 19,445,364 (GRCm39) F104S probably benign Het
Vmn2r88 T G 14: 51,651,565 (GRCm39) I293S probably damaging Het
Zfp251 C T 15: 76,738,436 (GRCm39) R219Q possibly damaging Het
Zfp930 A G 8: 69,680,820 (GRCm39) T171A probably benign Het
Other mutations in Sh3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Sh3bp2 APN 5 34,713,347 (GRCm39) missense probably damaging 0.99
IGL02478:Sh3bp2 APN 5 34,709,006 (GRCm39) missense probably damaging 1.00
IGL03196:Sh3bp2 APN 5 34,714,687 (GRCm39) missense probably damaging 1.00
IGL03329:Sh3bp2 APN 5 34,716,546 (GRCm39) missense probably benign 0.00
R0718:Sh3bp2 UTSW 5 34,712,839 (GRCm39) missense probably damaging 0.99
R1501:Sh3bp2 UTSW 5 34,712,920 (GRCm39) critical splice donor site probably null
R1573:Sh3bp2 UTSW 5 34,718,034 (GRCm39) missense probably benign 0.01
R1649:Sh3bp2 UTSW 5 34,716,348 (GRCm39) missense possibly damaging 0.61
R1939:Sh3bp2 UTSW 5 34,708,963 (GRCm39) missense probably damaging 1.00
R2021:Sh3bp2 UTSW 5 34,701,569 (GRCm39) critical splice acceptor site probably benign
R2372:Sh3bp2 UTSW 5 34,716,840 (GRCm39) missense probably benign 0.00
R2903:Sh3bp2 UTSW 5 34,700,900 (GRCm39) nonsense probably null
R3709:Sh3bp2 UTSW 5 34,709,002 (GRCm39) missense probably damaging 1.00
R4344:Sh3bp2 UTSW 5 34,712,886 (GRCm39) missense possibly damaging 0.86
R4391:Sh3bp2 UTSW 5 34,707,062 (GRCm39) missense probably benign
R5068:Sh3bp2 UTSW 5 34,714,311 (GRCm39) missense probably benign 0.00
R5637:Sh3bp2 UTSW 5 34,718,392 (GRCm39) missense possibly damaging 0.69
R5658:Sh3bp2 UTSW 5 34,714,291 (GRCm39) missense probably damaging 1.00
R6005:Sh3bp2 UTSW 5 34,719,809 (GRCm39) missense possibly damaging 0.65
R6014:Sh3bp2 UTSW 5 34,716,971 (GRCm39) missense probably benign 0.00
R6391:Sh3bp2 UTSW 5 34,718,947 (GRCm39) missense probably damaging 1.00
R6737:Sh3bp2 UTSW 5 34,719,818 (GRCm39) missense probably damaging 1.00
R7144:Sh3bp2 UTSW 5 34,718,975 (GRCm39) missense probably benign 0.00
R7536:Sh3bp2 UTSW 5 34,700,901 (GRCm39) missense probably benign
R7871:Sh3bp2 UTSW 5 34,716,429 (GRCm39) missense not run
R8775:Sh3bp2 UTSW 5 34,719,751 (GRCm39) missense probably damaging 1.00
R8775-TAIL:Sh3bp2 UTSW 5 34,719,751 (GRCm39) missense probably damaging 1.00
R9052:Sh3bp2 UTSW 5 34,709,164 (GRCm39) intron probably benign
R9180:Sh3bp2 UTSW 5 34,718,377 (GRCm39) nonsense probably null
R9350:Sh3bp2 UTSW 5 34,718,453 (GRCm39) critical splice donor site probably null
R9687:Sh3bp2 UTSW 5 34,716,977 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTGCTAGAATCAGTTCAGGGGTGG -3'
(R):5'- GGTCAGAGCCTCGTAATCAGTGTG -3'

Sequencing Primer
(F):5'- tccccacccctttcctc -3'
(R):5'- CGTAATCAGTGTGGCACTTCAG -3'
Posted On 2014-02-18