Mutagenetix > Incidental Mutations

Incidental Mutation 'R1465:Skap2'

165415

Institutional Source

Beutler Lab

Gene Symbol

Skap2

Ensembl Gene

ENSMUSG00000059182

Gene Name

src family associated phosphoprotein 2

Synonyms

Saps, RA70, SKAP-HOM, mSKAP55R, 2610021A10Rik

MMRRC Submission

039519-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1465 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51857422-52012549 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 51909368 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 5 (T5A)

Ref Sequence

ENSEMBL: ENSMUSP00000145275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078214] [ENSMUST00000203948] [ENSMUST00000204778]

Predicted Effect

probably benign
Transcript: ENSMUST00000078214
AA Change: T169A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077342
Gene: ENSMUSG00000059182
AA Change: T169A

Domain	Start	End	E-Value	Type
PH	117	221	6.11e-18	SMART
low complexity region	254	269	N/A	INTRINSIC
SH3	299	356	1.71e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000203948
AA Change: T5A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000145275
Gene: ENSMUSG00000059182
AA Change: T5A

Domain	Start	End	E-Value	Type
Blast:PH	1	49	1e-28	BLAST
PDB:1U5F\|A	1	74	1e-30	PDB
SH3	83	126	3e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204178

Predicted Effect

probably benign
Transcript: ENSMUST00000204778
AA Change: T176A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000145462
Gene: ENSMUSG00000059182
AA Change: T176A

Domain	Start	End	E-Value	Type
PH	117	221	6.11e-18	SMART
low complexity region	254	269	N/A	INTRINSIC
SH3	299	356	1.71e-15	SMART

Coding Region Coverage

1x: 99.2%
3x: 97.3%
10x: 87.6%
20x: 63.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares homology with Src kinase-associated phosphoprotein 1, and is a substrate of Src family kinases. It is an adaptor protein that is thought to play an essential role in the Src signaling pathway, and in regulating proper activation of the immune system. This protein contains an amino terminal coiled-coil domain for self-dimerization, a plecskstrin homology (PH) domain required for interactions with lipids at the membrane, and a Src homology (SH3) domain at the carboxy terminus. Some reports indicate that this protein inhibits actin polymerization through interactions with actin assembly factors, and might negatively regulate the invasiveness of tumors by modulating actin assembly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele are embryonic lethal. Homozygotes for a gene-trapped allele show impaired B-cell responses and B-cell adhesion, decreased susceptibility to EAE, abnormal dendritic cell physiology, fast extinction of fear memory, and impaired social memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310030G06Rik	A	G	9: 50,740,566	Y121H	probably damaging	Het
Abca13	G	T	11: 9,399,303	G3626W	probably damaging	Het
Acvr1c	A	G	2: 58,284,961	Y192H	probably damaging	Het
Afm	A	T	5: 90,550,341	D534V	probably damaging	Het
Agl	T	C	3: 116,771,372	E1076G	probably benign	Het
Angptl3	A	T	4: 99,037,520	H361L	probably benign	Het
Apob	T	C	12: 8,011,421	F3301S	possibly damaging	Het
Arhgef33	T	A	17: 80,367,301	C376S	possibly damaging	Het
Ass1	A	G	2: 31,520,416	*413W	probably null	Het
Atp6v1h	T	A	1: 5,095,688	L127Q	probably damaging	Het
Bcl2l1	G	A	2: 152,829,950	S14F	probably damaging	Het
Birc6	G	A	17: 74,623,858	A2477T	probably benign	Het
Bpifb9a	G	A	2: 154,271,021	A589T	possibly damaging	Het
Casp9	C	A	4: 141,805,840	T252K	probably benign	Het
Cct4	G	A	11: 23,002,922	D533N	probably damaging	Het
Clcn6	A	C	4: 148,013,901	I555S	probably damaging	Het
Col4a4	A	T	1: 82,497,822		probably null	Het
Cyp2d10	A	T	15: 82,403,928		probably null	Het
D930048N14Rik	A	G	11: 51,654,913		probably benign	Het
Dlg5	T	C	14: 24,154,696		probably null	Het
Dnah11	T	C	12: 118,038,695	E2240G	probably damaging	Het
Dnmt3a	A	G	12: 3,866,088	E17G	probably damaging	Het
Dock1	A	G	7: 134,782,409	T670A	probably benign	Het
Dpy19l2	A	G	9: 24,669,322	M241T	probably benign	Het
Dpy19l4	A	G	4: 11,296,034	S212P	probably damaging	Het
Ephb6	T	C	6: 41,616,106	F426S	probably damaging	Het
F5	A	T	1: 164,198,833	D1658V	probably benign	Het
Faah	A	T	4: 115,999,558	V469E	probably damaging	Het
Fas	T	C	19: 34,316,613	C123R	probably damaging	Het
Fhod1	T	C	8: 105,338,914		probably benign	Het
Filip1	A	G	9: 79,898,307	V55A	probably benign	Het
Frmpd1	G	A	4: 45,273,197	R372Q	probably damaging	Het
Glyctk	C	T	9: 106,157,607	G87S	probably damaging	Het
Gm4737	T	C	16: 46,153,848	K389E	probably benign	Het
Gm5096	T	G	18: 87,757,258	F302V	probably damaging	Het
Golga3	T	C	5: 110,209,878	L1080P	probably damaging	Het
Gpr137	T	C	19: 6,938,444	T281A	probably benign	Het
Grap2	T	A	15: 80,648,411		probably null	Het
Hlcs	T	C	16: 94,268,292	D170G	probably damaging	Het
Hook1	A	G	4: 96,013,256	T484A	probably benign	Het
Hoxa5	T	A	6: 52,203,791	H187L	probably benign	Het
Inpp1	G	T	1: 52,790,094	S255R	probably benign	Het
Inpp4b	T	A	8: 81,768,157	V67E	probably damaging	Het
Iqgap3	A	G	3: 88,087,309	N105S	probably damaging	Het
Kcnq5	A	G	1: 21,469,468		probably null	Het
Klhl1	T	C	14: 96,240,213	N473S	probably benign	Het
Klk1b24	C	A	7: 44,191,361	T71N	probably benign	Het
Loxhd1	A	G	18: 77,380,573		probably null	Het
Lrp1b	C	T	2: 41,111,059	R2165Q	probably benign	Het
Lrp2bp	A	T	8: 46,025,235	Q328L	possibly damaging	Het
Lrrc63	T	A	14: 75,107,389	K419N	possibly damaging	Het
Lrrc9	A	G	12: 72,500,759	N150S	probably benign	Het
Lrrn4	C	A	2: 132,872,075	C317F	probably damaging	Het
Ltbp2	T	C	12: 84,813,300	S627G	probably damaging	Het
Macf1	A	T	4: 123,493,154	S1224T	probably damaging	Het
Meis2	A	C	2: 116,058,670	H200Q	probably benign	Het
Mesd	C	A	7: 83,895,582	A80E	probably benign	Het
Mroh2a	G	C	1: 88,257,802	E1510D	probably damaging	Het
Myo3a	T	C	2: 22,577,927	F398L	probably benign	Het
Nanp	A	G	2: 151,030,829	C60R	probably benign	Het
Nectin2	T	G	7: 19,730,116	M313L	probably benign	Het
Nek4	C	T	14: 30,956,887	H123Y	probably damaging	Het
Nploc4	A	G	11: 120,408,781	V371A	probably damaging	Het
Olfr1463	T	A	19: 13,234,901	V217E	possibly damaging	Het
Olfr156	A	G	4: 43,820,723	F213L	probably benign	Het
Olfr658	T	C	7: 104,644,946	N140S	probably benign	Het
Olfr740	A	G	14: 50,453,177	T42A	possibly damaging	Het
Pcdh20	T	A	14: 88,469,237	Q209L	probably benign	Het
Pcdhb20	G	A	18: 37,504,697	R92H	probably damaging	Het
Pgap1	T	C	1: 54,528,555	H377R	probably benign	Het
Phyhipl	G	T	10: 70,570,968	P52Q	probably damaging	Het
Pwwp2a	T	A	11: 43,705,556	V516E	possibly damaging	Het
Rack1	T	C	11: 48,801,759	V69A	probably damaging	Het
Rexo5	T	A	7: 119,801,358		probably null	Het
Rock1	G	T	18: 10,072,863	Q1161K	possibly damaging	Het
Rps6ka2	T	C	17: 7,292,867	L568P	probably damaging	Het
Seh1l	T	C	18: 67,783,984	S78P	probably damaging	Het
Serpinb3b	A	T	1: 107,155,843		probably null	Het
Setd1a	T	C	7: 127,788,340		probably benign	Het
Setx	G	T	2: 29,140,389		probably null	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Shc2	G	T	10: 79,631,302	R146S	probably damaging	Het
Slc35a3	T	C	3: 116,687,334	I93M	probably benign	Het
Sohlh1	C	T	2: 25,843,347	G295D	probably damaging	Het
Sult2a8	A	C	7: 14,416,283	C168G	probably benign	Het
Tbc1d4	T	C	14: 101,447,688	I1176V	possibly damaging	Het
Thada	A	T	17: 84,436,676	F735I	possibly damaging	Het
Tle1	A	C	4: 72,139,831	H52Q	probably damaging	Het
Tmem101	A	T	11: 102,153,329	V244E	probably damaging	Het
Tnfrsf26	C	A	7: 143,617,931	C95F	probably damaging	Het
Uspl1	T	C	5: 149,214,032	S482P	probably benign	Het
Vmn2r118	G	T	17: 55,610,935	N192K	probably benign	Het
Vmn2r14	C	T	5: 109,220,329	V266I	possibly damaging	Het
Vmn2r51	A	G	7: 10,100,322	I263T	probably damaging	Het
Zfp937	T	A	2: 150,239,047	C332*	probably null	Het
Zscan21	T	A	5: 138,125,208	S50T	probably benign	Het

Other mutations in Skap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01462:Skap2	APN	6	51921300	missense	probably damaging	1.00
IGL01526:Skap2	APN	6	51907914	missense	probably benign	0.20
IGL01543:Skap2	APN	6	52012395	missense	possibly damaging	0.88
IGL01879:Skap2	APN	6	51996034	missense	possibly damaging	0.90
IGL01893:Skap2	APN	6	51874576	missense	probably damaging	1.00
IGL02154:Skap2	APN	6	52012328	splice site	probably benign
IGL02406:Skap2	APN	6	51874473	critical splice donor site	probably null
IGL02409:Skap2	APN	6	51907958	missense	possibly damaging	0.51
IGL02937:Skap2	APN	6	51909371	missense	probably benign	0.01
R0648:Skap2	UTSW	6	51879785	missense	probably benign	0.05
R1465:Skap2	UTSW	6	51909368	missense	probably benign	0.00
R2370:Skap2	UTSW	6	51921330	missense	probably damaging	1.00
R3837:Skap2	UTSW	6	51909299	critical splice donor site	probably null
R4847:Skap2	UTSW	6	52003669	missense	probably benign	0.01
R4939:Skap2	UTSW	6	51922323	missense	possibly damaging	0.49
R5555:Skap2	UTSW	6	51860018	missense	probably damaging	1.00
R7703:Skap2	UTSW	6	51907954	missense	probably benign	0.00
R8176:Skap2	UTSW	6	51907898	missense	probably damaging	1.00
R8317:Skap2	UTSW	6	51907885	critical splice donor site	probably null
Z1176:Skap2	UTSW	6	51921280	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGATGCCTGGCTGATGGCTC -3'
(R):5'- CTTCTGAATAGCACCACAGACCTCTTC -3'

Sequencing Primer
(F):5'- CGTTGTAGAGCTGATAATGCATC -3'
(R):5'- GACCTCTTCCTCCATTTCCCTAATAG -3'

Posted On

2014-03-28