Incidental Mutation 'R1523:Ccr10'
ID167658
Institutional Source Beutler Lab
Gene Symbol Ccr10
Ensembl Gene ENSMUSG00000044052
Gene Namechemokine (C-C motif) receptor 10
SynonymsCmkbr9, GPR2, CCR10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1523 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101172997-101175443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101173675 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 343 (R343Q)
Ref Sequence ENSEMBL: ENSMUSP00000062588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043397] [ENSMUST00000062759] [ENSMUST00000103109] [ENSMUST00000123864] [ENSMUST00000129895] [ENSMUST00000164474]
Predicted Effect probably benign
Transcript: ENSMUST00000043397
SMART Domains Protein: ENSMUSP00000046044
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 285 398 4.2e-21 PFAM
B41 400 664 2.91e-4 SMART
low complexity region 750 766 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062759
AA Change: R343Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062588
Gene: ENSMUSG00000044052
AA Change: R343Q

DomainStartEndE-ValueType
Pfam:7tm_1 58 310 4.8e-43 PFAM
low complexity region 313 329 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103109
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123864
SMART Domains Protein: ENSMUSP00000120865
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
PH 95 200 1.9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129895
SMART Domains Protein: ENSMUSP00000137841
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 281 399 2.7e-16 PFAM
B41 400 664 5.17e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138942
Predicted Effect probably benign
Transcript: ENSMUST00000164474
SMART Domains Protein: ENSMUSP00000127088
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 281 399 3.3e-16 PFAM
B41 400 661 6.14e-4 SMART
low complexity region 747 763 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC, based on the arrangement of the first 2 of the 4 conserved cysteine residues; the 2 cysteines are separated by a single amino acid in CXC chemokines and are adjacent in CC chemokines. CCR10 is the receptor for CCL27 (SCYA27; MIM 604833); CCR10-CCL27 interactions are involved in T cell-mediated skin inflammation (Homey et al., 2002 [PubMed 11821900]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for null mutation are viable and fertile, without any detectable neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
4930503B20Rik A G 3: 146,651,109 S15P probably damaging Het
4933402E13Rik T A X: 62,290,906 D177E probably benign Het
5530400C23Rik A G 6: 133,294,293 E100G possibly damaging Het
Abcg2 T C 6: 58,685,694 F507S possibly damaging Het
Adgrf5 A T 17: 43,450,153 Q913L probably benign Het
Ak7 A T 12: 105,766,608 N537I probably benign Het
Anks1 T A 17: 28,051,655 probably null Het
Arhgap32 T A 9: 32,256,752 V677D probably damaging Het
Arnt C T 3: 95,489,654 P466L possibly damaging Het
Arrb1 T G 7: 99,594,665 L274R probably damaging Het
Atf2 A T 2: 73,863,208 D3E probably damaging Het
Baz2b C T 2: 59,968,637 R381Q possibly damaging Het
Cacna1g C T 11: 94,442,729 probably null Het
Clca2 G T 3: 145,071,644 S822* probably null Het
Col12a1 A T 9: 79,660,996 Y1649N probably benign Het
Col23a1 G A 11: 51,561,916 probably null Het
Cp T C 3: 19,989,065 Y1006H probably benign Het
Ctbs A G 3: 146,454,980 T101A probably benign Het
Cyp4a31 T C 4: 115,569,754 F170L probably benign Het
Dock1 A C 7: 134,744,247 I173L possibly damaging Het
Dock4 A G 12: 40,693,025 D393G possibly damaging Het
Dsg1a T A 18: 20,322,317 S113T probably damaging Het
Epha3 T C 16: 63,610,948 D530G probably damaging Het
Erbb4 T A 1: 68,396,252 H162L possibly damaging Het
Fam131c C T 4: 141,382,831 T180I probably benign Het
Fndc1 A G 17: 7,773,209 S552P unknown Het
Foxf1 A G 8: 121,084,558 probably null Het
Frem2 T C 3: 53,655,407 T560A possibly damaging Het
Gabra4 G A 5: 71,633,632 T289M probably damaging Het
Gcnt1 A G 19: 17,329,833 V176A probably damaging Het
Gemin8 G A X: 166,180,648 S100N probably benign Het
Gm1527 T C 3: 28,920,418 I460T probably damaging Het
Gm6729 A G 10: 86,540,175 noncoding transcript Het
Gprin2 T C 14: 34,195,079 S245G probably benign Het
Gsdmc A T 15: 63,803,630 I112N probably damaging Het
Hspb6 A G 7: 30,553,423 D30G probably benign Het
Hydin A G 8: 110,533,271 D2625G probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf2 T A 8: 46,837,840 probably null Het
Kdm3b T C 18: 34,793,173 probably null Het
Khdc3 G A 9: 73,103,491 E208K possibly damaging Het
Kifc1 A T 17: 33,883,662 S263T probably benign Het
Lrig3 C A 10: 126,008,698 T677K probably damaging Het
Mapkapk3 A T 9: 107,263,623 probably null Het
Mertk T C 2: 128,790,328 probably null Het
Metrn A G 17: 25,794,977 *292R probably null Het
Mllt6 G T 11: 97,665,023 A60S probably damaging Het
Mmp21 T C 7: 133,679,045 I65M probably benign Het
Myo7b A G 18: 31,966,876 L1651P probably damaging Het
Nhsl1 A G 10: 18,408,355 S15G probably benign Het
Nos1ap T C 1: 170,338,118 D192G probably benign Het
Nrcam A G 12: 44,572,249 T844A probably damaging Het
Pax4 A G 6: 28,444,841 L203P probably damaging Het
Pbld2 T C 10: 63,076,433 I280T probably benign Het
Pclo A G 5: 14,788,406 Y4681C unknown Het
Phyhip T A 14: 70,461,760 M1K probably null Het
Plppr4 T C 3: 117,322,841 N456D probably damaging Het
Prpf31 T C 7: 3,640,857 Y473H probably damaging Het
Rapgef2 A T 3: 79,092,749 V564D probably damaging Het
Rexo1 T C 10: 80,542,751 S1123G probably benign Het
Rnasel C A 1: 153,756,013 Q513K probably damaging Het
Rnf165 G A 18: 77,462,938 T98I probably benign Het
Rnf213 T C 11: 119,441,888 V2641A probably damaging Het
Rnf40 G T 7: 127,590,615 R184L probably damaging Het
Rnf8 A G 17: 29,626,972 K179R probably damaging Het
Sipa1l2 C T 8: 125,447,613 D1309N possibly damaging Het
Slc25a38 T A 9: 120,123,703 M307K possibly damaging Het
Snx33 T C 9: 56,926,182 D201G possibly damaging Het
Sulf1 T A 1: 12,817,350 Y249* probably null Het
Sult2a4 G A 7: 13,909,860 Q261* probably null Het
Syndig1 G A 2: 150,003,234 A226T probably damaging Het
Tcaf2 C T 6: 42,624,451 W891* probably null Het
Tcf15 C A 2: 152,143,888 T88K probably damaging Het
Tmem19 A T 10: 115,347,217 M117K probably damaging Het
Trim32 T C 4: 65,614,004 L266P probably benign Het
Vmn2r11 T C 5: 109,053,841 I266V probably benign Het
Vmn2r73 A T 7: 85,870,278 Y491N probably benign Het
Wrn C T 8: 33,292,716 E486K probably benign Het
Zfp457 T C 13: 67,293,437 E262G probably damaging Het
Zfp598 A G 17: 24,678,629 D308G probably null Het
Zufsp T C 10: 33,927,440 I549M probably damaging Het
Other mutations in Ccr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Ccr10 APN 11 101174666 missense probably benign 0.01
R1696:Ccr10 UTSW 11 101174384 missense probably benign 0.25
R5275:Ccr10 UTSW 11 101174285 missense possibly damaging 0.92
R5295:Ccr10 UTSW 11 101174285 missense possibly damaging 0.92
R5418:Ccr10 UTSW 11 101174078 missense probably benign 0.16
R6219:Ccr10 UTSW 11 101174549 missense possibly damaging 0.85
R7161:Ccr10 UTSW 11 101174278 missense probably benign 0.02
R7674:Ccr10 UTSW 11 101174649 missense probably benign
Z1176:Ccr10 UTSW 11 101174323 missense probably damaging 1.00
Z1176:Ccr10 UTSW 11 101174340 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGCTGCAACCAAAGCTGGTAATTC -3'
(R):5'- TGCTGCTGGATACAGCCGATCTAC -3'

Sequencing Primer
(F):5'- GCGCAGAGGCAATCTCTTTAG -3'
(R):5'- GATACAGCCGATCTACTGGCAG -3'
Posted On2014-04-13