Incidental Mutation 'R1555:Tedc1'
ID170235
Institutional Source Beutler Lab
Gene Symbol Tedc1
Ensembl Gene ENSMUSG00000037466
Gene Nametubulin epsilon and delta complex 1
Synonyms4930427A07Rik
MMRRC Submission 039594-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1555 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113156421-113166048 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 113156497 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006523] [ENSMUST00000049271] [ENSMUST00000196755] [ENSMUST00000199089] [ENSMUST00000200522] [ENSMUST00000200553]
Predicted Effect probably benign
Transcript: ENSMUST00000006523
SMART Domains Protein: ENSMUSP00000006523
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000049271
AA Change: A21S
SMART Domains Protein: ENSMUSP00000035351
Gene: ENSMUSG00000037466
AA Change: A21S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DUF4509 41 221 4.8e-65 PFAM
low complexity region 233 245 N/A INTRINSIC
Pfam:DUF4510 258 418 3.1e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196505
Predicted Effect unknown
Transcript: ENSMUST00000196755
AA Change: A20S
SMART Domains Protein: ENSMUSP00000143431
Gene: ENSMUSG00000037466
AA Change: A20S

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
Pfam:DUF4509 40 138 4.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198909
Predicted Effect probably benign
Transcript: ENSMUST00000199089
SMART Domains Protein: ENSMUSP00000142803
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 54 106 9.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199382
Predicted Effect probably benign
Transcript: ENSMUST00000200522
Predicted Effect probably benign
Transcript: ENSMUST00000200553
SMART Domains Protein: ENSMUSP00000143680
Gene: ENSMUSG00000006360

DomainStartEndE-ValueType
LIM 3 55 2e-14 SMART
Meta Mutation Damage Score 0.1038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,974,901 probably null Het
Adamts1 T A 16: 85,797,888 T358S probably benign Het
Ate1 A T 7: 130,509,091 F169I probably benign Het
Cdkl4 T A 17: 80,543,614 probably benign Het
Clcnkb T C 4: 141,411,739 probably null Het
Col6a4 C T 9: 106,000,886 R1964Q possibly damaging Het
Dcakd C T 11: 103,000,213 V17I probably damaging Het
Dcdc5 T G 2: 106,384,135 noncoding transcript Het
Erc2 T A 14: 28,011,665 D557E probably damaging Het
Grid2 A T 6: 64,429,684 D676V possibly damaging Het
Hebp2 G T 10: 18,544,415 T90K possibly damaging Het
Igkv10-96 C T 6: 68,632,381 probably benign Het
Mier3 T A 13: 111,708,359 N248K probably damaging Het
Myo5b A T 18: 74,569,782 I15F probably damaging Het
Neurl3 A G 1: 36,266,532 V198A probably benign Het
Notch2 C A 3: 98,131,340 N1266K possibly damaging Het
Nup107 A G 10: 117,751,490 probably benign Het
Olfr214 A T 6: 116,556,826 I134F probably damaging Het
Olfr675 T C 7: 105,024,522 I153V probably benign Het
Phf3 G T 1: 30,805,877 H1334N possibly damaging Het
Phyhd1 T A 2: 30,274,706 I100N probably damaging Het
Rad21l T A 2: 151,658,428 T224S probably benign Het
Rxra C T 2: 27,748,678 A231V probably benign Het
Sac3d1 T C 19: 6,118,405 D61G probably damaging Het
Sbf1 A G 15: 89,305,076 Y481H probably damaging Het
Spg11 T C 2: 122,097,377 E642G probably damaging Het
Spta1 A G 1: 174,178,749 Y159C probably damaging Het
Sry C G Y: 2,662,975 Q228H unknown Het
Tmem200a A T 10: 25,993,884 D162E probably damaging Het
Tmprss11e T A 5: 86,715,588 Q206L probably damaging Het
Tpra1 A G 6: 88,910,203 N175S probably damaging Het
Ttll10 T C 4: 156,035,139 E601G probably benign Het
Ttll6 G T 11: 96,145,582 D346Y probably damaging Het
U2surp A G 9: 95,466,577 V874A probably damaging Het
Vwa5b1 T C 4: 138,605,477 K258R probably benign Het
Xkr6 A G 14: 63,818,925 Y95C unknown Het
Zfp180 T C 7: 24,101,574 probably benign Het
Zfp90 A G 8: 106,424,095 T147A probably benign Het
Other mutations in Tedc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Tedc1 APN 12 113163150 missense probably damaging 0.97
IGL01074:Tedc1 APN 12 113163188 nonsense probably null
IGL01075:Tedc1 APN 12 113163188 nonsense probably null
IGL01077:Tedc1 APN 12 113163188 nonsense probably null
IGL01084:Tedc1 APN 12 113163188 nonsense probably null
IGL01103:Tedc1 APN 12 113163188 nonsense probably null
IGL01108:Tedc1 APN 12 113163188 nonsense probably null
IGL01137:Tedc1 APN 12 113163188 nonsense probably null
IGL01142:Tedc1 APN 12 113163188 nonsense probably null
IGL01149:Tedc1 APN 12 113163188 nonsense probably null
IGL01150:Tedc1 APN 12 113163188 nonsense probably null
IGL01151:Tedc1 APN 12 113163188 nonsense probably null
IGL02646:Tedc1 APN 12 113157301 missense possibly damaging 0.68
IGL02989:Tedc1 APN 12 113163321 missense probably benign 0.09
ANU05:Tedc1 UTSW 12 113163188 nonsense probably null
ANU22:Tedc1 UTSW 12 113163188 nonsense probably null
R1309:Tedc1 UTSW 12 113161780 missense probably benign
R2092:Tedc1 UTSW 12 113157720 missense probably damaging 1.00
R3053:Tedc1 UTSW 12 113156467 unclassified probably benign
R4130:Tedc1 UTSW 12 113163208 missense probably benign 0.01
R5050:Tedc1 UTSW 12 113156705 missense possibly damaging 0.86
R5386:Tedc1 UTSW 12 113156682 missense probably benign 0.03
R6377:Tedc1 UTSW 12 113161355 missense probably damaging 1.00
R6749:Tedc1 UTSW 12 113158082 missense probably damaging 1.00
R6761:Tedc1 UTSW 12 113161714 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGGAGTTGGCACCTCCAATC -3'
(R):5'- AGCACTGGAGCCTGAAGCAAAC -3'

Sequencing Primer
(F):5'- TGGTAGGCACTCAAACGC -3'
(R):5'- ACGAGGAGTTTGTAGTCAGC -3'
Posted On2014-04-13