Incidental Mutation 'R1665:Gnb4'
ID187090
Institutional Source Beutler Lab
Gene Symbol Gnb4
Ensembl Gene ENSMUSG00000027669
Gene Nameguanine nucleotide binding protein (G protein), beta 4
Synonyms
MMRRC Submission 039701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1665 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32580332-32616585 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 32590039 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 152 (L152*)
Ref Sequence ENSEMBL: ENSMUSP00000121127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108234] [ENSMUST00000155737] [ENSMUST00000184130] [ENSMUST00000193050]
Predicted Effect probably null
Transcript: ENSMUST00000108234
AA Change: L152*
SMART Domains Protein: ENSMUSP00000103869
Gene: ENSMUSG00000027669
AA Change: L152*

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 2.26e-7 SMART
WD40 86 125 3.22e-3 SMART
WD40 132 170 1.11e-6 SMART
WD40 173 212 1.96e-7 SMART
WD40 215 254 9.16e-8 SMART
WD40 257 298 2.8e-3 SMART
WD40 301 340 1.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152901
Predicted Effect probably null
Transcript: ENSMUST00000155737
AA Change: L152*
SMART Domains Protein: ENSMUSP00000121127
Gene: ENSMUSG00000027669
AA Change: L152*

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 2.26e-7 SMART
WD40 86 125 3.22e-3 SMART
WD40 132 170 1.11e-6 SMART
WD40 173 212 1.96e-7 SMART
WD40 215 254 9.16e-8 SMART
WD40 257 298 2.8e-3 SMART
WD40 301 340 1.44e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184130
SMART Domains Protein: ENSMUSP00000138886
Gene: ENSMUSG00000027669

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192116
Predicted Effect probably benign
Transcript: ENSMUST00000193050
SMART Domains Protein: ENSMUSP00000141196
Gene: ENSMUSG00000027669

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
PDB:4KFM|B 18 68 8e-24 PDB
SCOP:d1g72a_ 36 68 4e-3 SMART
Blast:WD40 44 72 2e-11 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Gnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Gnb4 APN 3 32593169 missense probably benign 0.01
IGL02527:Gnb4 APN 3 32589866 missense probably benign 0.01
IGL02589:Gnb4 APN 3 32589849 missense probably damaging 1.00
IGL02640:Gnb4 APN 3 32591225 missense probably benign 0.09
IGL02966:Gnb4 APN 3 32585223 missense probably benign 0.19
IGL03225:Gnb4 APN 3 32587732 missense probably damaging 0.98
IGL03248:Gnb4 APN 3 32585175 missense probably damaging 1.00
R0619:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R0620:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R0621:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R1278:Gnb4 UTSW 3 32587737 missense probably damaging 1.00
R1661:Gnb4 UTSW 3 32590039 nonsense probably null
R1970:Gnb4 UTSW 3 32598141 missense probably damaging 1.00
R4915:Gnb4 UTSW 3 32585087 utr 3 prime probably benign
R5452:Gnb4 UTSW 3 32589845 missense probably benign 0.06
R5618:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R6603:Gnb4 UTSW 3 32585146 missense probably damaging 1.00
R7681:Gnb4 UTSW 3 32587753 missense possibly damaging 0.51
R7791:Gnb4 UTSW 3 32590043 missense possibly damaging 0.84
R7822:Gnb4 UTSW 3 32596331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCAATGTCCCACAAAGCACTG -3'
(R):5'- TCGTGCAAACACAGCATTTTCCAG -3'

Sequencing Primer
(F):5'- AGCACTGTGATTAACACAAGC -3'
(R):5'- cataaacataccgaaaataaagcctc -3'
Posted On2014-05-09