Incidental Mutation 'R1720:Anapc2'
ID191347
Institutional Source Beutler Lab
Gene Symbol Anapc2
Ensembl Gene ENSMUSG00000026965
Gene Nameanaphase promoting complex subunit 2
SynonymsEmi4, 9230107K09Rik, Imi4, expressed during mesenchymal induction 4, APC2
MMRRC Submission 039752-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1720 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25272478-25285915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25274712 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 36 (D36G)
Ref Sequence ENSEMBL: ENSMUSP00000115177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028341] [ENSMUST00000028342] [ENSMUST00000114336] [ENSMUST00000129300]
Predicted Effect probably benign
Transcript: ENSMUST00000028341
AA Change: D322G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028341
Gene: ENSMUSG00000026965
AA Change: D322G

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
CULLIN 515 663 6.72e-9 SMART
APC2 772 832 3.67e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028342
SMART Domains Protein: ENSMUSP00000028342
Gene: ENSMUSG00000026966

DomainStartEndE-ValueType
coiled coil region 13 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114336
SMART Domains Protein: ENSMUSP00000109975
Gene: ENSMUSG00000048707

DomainStartEndE-ValueType
Pfam:Phostensin_N 8 89 8.3e-38 PFAM
low complexity region 105 117 N/A INTRINSIC
internal_repeat_1 149 273 1.71e-5 PROSPERO
low complexity region 290 322 N/A INTRINSIC
low complexity region 401 410 N/A INTRINSIC
Pfam:Phostensin 506 645 1.8e-65 PFAM
low complexity region 647 665 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129265
Predicted Effect probably benign
Transcript: ENSMUST00000129300
AA Change: D36G

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000115177
Gene: ENSMUSG00000026965
AA Change: D36G

DomainStartEndE-ValueType
low complexity region 170 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141470
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle by ubiquitinating its specific substrates, such as mitotic cyclins and anaphase inhibitor, for subsequent degradation by the proteasome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before E6.5. Conditional ablation in the liver results in liver failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,609 F146L probably damaging Het
9330182L06Rik T G 5: 9,428,407 C424G probably damaging Het
Acot5 A G 12: 84,075,881 D413G probably benign Het
Actr5 G T 2: 158,636,137 V476F possibly damaging Het
Adhfe1 G A 1: 9,566,900 D426N probably benign Het
Adra1a T C 14: 66,638,278 L234P probably damaging Het
Akap9 G T 5: 3,972,791 V1207L possibly damaging Het
Apol8 A G 15: 77,749,366 S337P possibly damaging Het
Asxl3 A T 18: 22,452,435 D139V probably damaging Het
Atp13a4 A T 16: 29,408,928 V1037E probably damaging Het
Baat A T 4: 49,490,231 F284L probably benign Het
C1qtnf6 A T 15: 78,527,440 F40Y probably damaging Het
Caskin2 G A 11: 115,802,782 H508Y probably damaging Het
Cass4 A T 2: 172,427,734 I579F probably damaging Het
Cdk15 A G 1: 59,289,758 Y277C probably damaging Het
Cit G A 5: 115,967,897 D947N probably damaging Het
Clint1 T A 11: 45,887,410 I126K probably damaging Het
Col6a4 C T 9: 106,026,472 G1640E probably damaging Het
Ddx10 T C 9: 53,238,071 K119E probably damaging Het
Dennd1a G A 2: 37,800,197 Q964* probably null Het
Dnhd1 T C 7: 105,693,828 F1460L probably benign Het
Edc3 T C 9: 57,748,179 probably null Het
Edn1 A G 13: 42,305,350 E163G probably benign Het
Efl1 A T 7: 82,683,721 D317V possibly damaging Het
F2 A T 2: 91,628,830 Y430* probably null Het
Faap100 C T 11: 120,374,581 V490M probably damaging Het
Fuz G T 7: 44,896,991 G104W probably damaging Het
Greb1l C A 18: 10,553,848 H1616Q probably benign Het
Grm1 G T 10: 10,746,794 probably null Het
Gucy2d G T 7: 98,477,230 A1098S probably benign Het
H1f0 T A 15: 79,028,995 S92T possibly damaging Het
Hbb-bt T A 7: 103,813,876 probably benign Het
Heg1 G A 16: 33,707,179 A170T probably benign Het
Hspa4l A T 3: 40,781,617 K578* probably null Het
Ikbke A G 1: 131,259,210 S582P possibly damaging Het
Itga6 T A 2: 71,820,166 F185L probably damaging Het
Itgal T A 7: 127,306,927 D396E probably benign Het
Kif5b T C 18: 6,213,427 H687R probably benign Het
Kmt2c T C 5: 25,299,184 N3709D probably benign Het
Lipf A T 19: 33,965,666 K125* probably null Het
Lrif1 A T 3: 106,733,136 E512D probably damaging Het
Matn2 T A 15: 34,345,274 Y142* probably null Het
Med13l A G 5: 118,741,995 T1051A probably damaging Het
Mpp3 T A 11: 102,025,756 M1L possibly damaging Het
Mro C T 18: 73,876,735 S159L probably benign Het
Myh15 T A 16: 49,092,782 D367E probably damaging Het
Myo1g T C 11: 6,512,490 Q547R probably benign Het
Neb T C 2: 52,207,721 I902M probably benign Het
Nsd1 G A 13: 55,246,898 D771N probably damaging Het
Olfr1507 A C 14: 52,490,594 Y40* probably null Het
Olfr248 A G 1: 174,391,920 I284V probably benign Het
Olfr294 T C 7: 86,616,456 N63S probably damaging Het
Olfr434 T C 6: 43,217,560 S216P probably damaging Het
Olfr912 C T 9: 38,581,289 T4I probably benign Het
Penk A G 4: 4,134,240 Y136H probably damaging Het
Prdm6 C T 18: 53,540,200 S144L probably benign Het
Ptprq T A 10: 107,686,294 I599F probably damaging Het
Racgap1 A T 15: 99,628,769 C304* probably null Het
Rbp3 T C 14: 33,956,909 V938A probably benign Het
Rpp30 A G 19: 36,094,427 K132E probably damaging Het
Rxfp2 A T 5: 150,043,099 R101* probably null Het
Ryr1 A T 7: 29,101,870 V823E probably damaging Het
S100pbp A T 4: 129,182,093 D146E probably damaging Het
Sdr9c7 T A 10: 127,902,258 V135E probably damaging Het
Serpinb12 A G 1: 106,946,614 D23G probably damaging Het
Serpinf1 T A 11: 75,413,981 T185S probably null Het
Slc23a1 A C 18: 35,625,851 C96G possibly damaging Het
Slc5a4a C T 10: 76,189,269 probably null Het
Suco A T 1: 161,834,054 L936Q probably damaging Het
Tmem144 T C 3: 79,825,299 Y224C probably damaging Het
Tpm4 T A 8: 72,144,754 probably null Het
Ttn T C 2: 76,730,070 E29329G probably damaging Het
Txn1 T C 4: 57,943,922 I101V probably benign Het
Ube2o A T 11: 116,544,607 C452S probably benign Het
Uhrf1bp1l T C 10: 89,782,586 V141A probably damaging Het
Uxs1 A T 1: 43,764,921 I278N probably damaging Het
Vps54 T C 11: 21,306,519 F663L probably damaging Het
Wdfy3 CG C 5: 101,926,525 probably null Het
Zc3h11a A G 1: 133,621,701 S741P probably damaging Het
Zdbf2 G A 1: 63,303,277 V272I possibly damaging Het
Zdhhc24 A G 19: 4,878,951 N68S probably damaging Het
Znfx1 A T 2: 167,044,066 L858* probably null Het
Other mutations in Anapc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Anapc2 APN 2 25274782 missense possibly damaging 0.65
IGL01575:Anapc2 APN 2 25285176 splice site probably benign
IGL01993:Anapc2 APN 2 25274713 missense probably benign 0.00
IGL02586:Anapc2 APN 2 25285096 missense probably benign 0.08
IGL02721:Anapc2 APN 2 25274668 nonsense probably null
FR4976:Anapc2 UTSW 2 25272532 unclassified probably benign
R0415:Anapc2 UTSW 2 25278325 missense probably damaging 1.00
R1539:Anapc2 UTSW 2 25273063 missense probably benign
R1675:Anapc2 UTSW 2 25272639 missense possibly damaging 0.88
R2150:Anapc2 UTSW 2 25272670 missense probably benign 0.27
R2173:Anapc2 UTSW 2 25273276 missense probably benign 0.01
R4028:Anapc2 UTSW 2 25277738 missense probably damaging 1.00
R4254:Anapc2 UTSW 2 25273345 missense probably benign 0.08
R4643:Anapc2 UTSW 2 25276394 missense probably benign
R4742:Anapc2 UTSW 2 25273543 splice site probably null
R4824:Anapc2 UTSW 2 25277752 missense probably damaging 1.00
R5039:Anapc2 UTSW 2 25274796 missense possibly damaging 0.70
R5530:Anapc2 UTSW 2 25284583 missense possibly damaging 0.81
R6456:Anapc2 UTSW 2 25280195 missense probably damaging 1.00
R6479:Anapc2 UTSW 2 25285395 missense probably benign 0.04
R6587:Anapc2 UTSW 2 25272538 unclassified probably benign
R7164:Anapc2 UTSW 2 25284999 missense probably damaging 1.00
R7494:Anapc2 UTSW 2 25276364 missense possibly damaging 0.95
R7829:Anapc2 UTSW 2 25277741 missense probably damaging 1.00
RF042:Anapc2 UTSW 2 25272561 unclassified probably benign
RF043:Anapc2 UTSW 2 25272561 unclassified probably benign
RF062:Anapc2 UTSW 2 25272537 frame shift probably null
X0025:Anapc2 UTSW 2 25279278 missense probably benign 0.01
Z1088:Anapc2 UTSW 2 25273368 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTCTTGGCCTAGAGTCGTAAAC -3'
(R):5'- TCAGAGGGAGTCTACCATGCTCAC -3'

Sequencing Primer
(F):5'- GTCGTAAACTTGGAAACTCCTGG -3'
(R):5'- GCAAAGGCAATCACTGGG -3'
Posted On2014-05-14