Mutagenetix > Incidental Mutation

Incidental Mutation 'R1720:Zdbf2'

191340

Institutional Source

Beutler Lab

Gene Symbol

Zdbf2

Ensembl Gene

ENSMUSG00000027520

Gene Name

zinc finger, DBF-type containing 2

Synonyms

4930431J08Rik, 9330107J05Rik

MMRRC Submission

039752-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R1720 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63273265-63314576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 63303277 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 272 (V272I)

Ref Sequence

ENSEMBL: ENSMUSP00000109767 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]

AlphaFold

Q5SS00

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029025
AA Change: V272I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: V272I

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083151

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114132
AA Change: V272I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: V272I

Domain	Start	End	E-Value	Type
low complexity region	79	99	N/A	INTRINSIC
low complexity region	150	164	N/A	INTRINSIC
low complexity region	378	405	N/A	INTRINSIC
internal_repeat_6	407	565	7.68e-5	PROSPERO
internal_repeat_5	418	768	5.53e-5	PROSPERO
internal_repeat_1	618	873	3.17e-15	PROSPERO
internal_repeat_4	621	885	2.09e-6	PROSPERO
internal_repeat_3	642	886	1.52e-7	PROSPERO
internal_repeat_2	650	912	5.87e-11	PROSPERO
internal_repeat_6	722	891	7.68e-5	PROSPERO
low complexity region	965	982	N/A	INTRINSIC
internal_repeat_4	1061	1328	2.09e-6	PROSPERO
internal_repeat_2	1215	1484	5.87e-11	PROSPERO
internal_repeat_3	1287	1507	1.52e-7	PROSPERO
internal_repeat_1	1307	1536	3.17e-15	PROSPERO
internal_repeat_5	1388	1758	5.53e-5	PROSPERO
low complexity region	1767	1778	N/A	INTRINSIC
low complexity region	2211	2235	N/A	INTRINSIC
low complexity region	2240	2399	N/A	INTRINSIC
low complexity region	2402	2420	N/A	INTRINSIC
low complexity region	2446	2458	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	G	11: 97,771,609	F146L	probably damaging	Het
9330182L06Rik	T	G	5: 9,428,407	C424G	probably damaging	Het
Acot5	A	G	12: 84,075,881	D413G	probably benign	Het
Actr5	G	T	2: 158,636,137	V476F	possibly damaging	Het
Adhfe1	G	A	1: 9,566,900	D426N	probably benign	Het
Adra1a	T	C	14: 66,638,278	L234P	probably damaging	Het
Akap9	G	T	5: 3,972,791	V1207L	possibly damaging	Het
Anapc2	A	G	2: 25,274,712	D36G	probably benign	Het
Apol8	A	G	15: 77,749,366	S337P	possibly damaging	Het
Asxl3	A	T	18: 22,452,435	D139V	probably damaging	Het
Atp13a4	A	T	16: 29,408,928	V1037E	probably damaging	Het
Baat	A	T	4: 49,490,231	F284L	probably benign	Het
C1qtnf6	A	T	15: 78,527,440	F40Y	probably damaging	Het
Caskin2	G	A	11: 115,802,782	H508Y	probably damaging	Het
Cass4	A	T	2: 172,427,734	I579F	probably damaging	Het
Cdk15	A	G	1: 59,289,758	Y277C	probably damaging	Het
Cit	G	A	5: 115,967,897	D947N	probably damaging	Het
Clint1	T	A	11: 45,887,410	I126K	probably damaging	Het
Col6a4	C	T	9: 106,026,472	G1640E	probably damaging	Het
Ddx10	T	C	9: 53,238,071	K119E	probably damaging	Het
Dennd1a	G	A	2: 37,800,197	Q964*	probably null	Het
Dnhd1	T	C	7: 105,693,828	F1460L	probably benign	Het
Edc3	T	C	9: 57,748,179		probably null	Het
Edn1	A	G	13: 42,305,350	E163G	probably benign	Het
Efl1	A	T	7: 82,683,721	D317V	possibly damaging	Het
F2	A	T	2: 91,628,830	Y430*	probably null	Het
Faap100	C	T	11: 120,374,581	V490M	probably damaging	Het
Fuz	G	T	7: 44,896,991	G104W	probably damaging	Het
Greb1l	C	A	18: 10,553,848	H1616Q	probably benign	Het
Grm1	G	T	10: 10,746,794		probably null	Het
Gucy2d	G	T	7: 98,477,230	A1098S	probably benign	Het
H1f0	T	A	15: 79,028,995	S92T	possibly damaging	Het
Hbb-bt	T	A	7: 103,813,876		probably benign	Het
Heg1	G	A	16: 33,707,179	A170T	probably benign	Het
Hspa4l	A	T	3: 40,781,617	K578*	probably null	Het
Ikbke	A	G	1: 131,259,210	S582P	possibly damaging	Het
Itga6	T	A	2: 71,820,166	F185L	probably damaging	Het
Itgal	T	A	7: 127,306,927	D396E	probably benign	Het
Kif5b	T	C	18: 6,213,427	H687R	probably benign	Het
Kmt2c	T	C	5: 25,299,184	N3709D	probably benign	Het
Lipf	A	T	19: 33,965,666	K125*	probably null	Het
Lrif1	A	T	3: 106,733,136	E512D	probably damaging	Het
Matn2	T	A	15: 34,345,274	Y142*	probably null	Het
Med13l	A	G	5: 118,741,995	T1051A	probably damaging	Het
Mpp3	T	A	11: 102,025,756	M1L	possibly damaging	Het
Mro	C	T	18: 73,876,735	S159L	probably benign	Het
Myh15	T	A	16: 49,092,782	D367E	probably damaging	Het
Myo1g	T	C	11: 6,512,490	Q547R	probably benign	Het
Neb	T	C	2: 52,207,721	I902M	probably benign	Het
Nsd1	G	A	13: 55,246,898	D771N	probably damaging	Het
Olfr1507	A	C	14: 52,490,594	Y40*	probably null	Het
Olfr248	A	G	1: 174,391,920	I284V	probably benign	Het
Olfr294	T	C	7: 86,616,456	N63S	probably damaging	Het
Olfr434	T	C	6: 43,217,560	S216P	probably damaging	Het
Olfr912	C	T	9: 38,581,289	T4I	probably benign	Het
Penk	A	G	4: 4,134,240	Y136H	probably damaging	Het
Prdm6	C	T	18: 53,540,200	S144L	probably benign	Het
Ptprq	T	A	10: 107,686,294	I599F	probably damaging	Het
Racgap1	A	T	15: 99,628,769	C304*	probably null	Het
Rbp3	T	C	14: 33,956,909	V938A	probably benign	Het
Rpp30	A	G	19: 36,094,427	K132E	probably damaging	Het
Rxfp2	A	T	5: 150,043,099	R101*	probably null	Het
Ryr1	A	T	7: 29,101,870	V823E	probably damaging	Het
S100pbp	A	T	4: 129,182,093	D146E	probably damaging	Het
Sdr9c7	T	A	10: 127,902,258	V135E	probably damaging	Het
Serpinb12	A	G	1: 106,946,614	D23G	probably damaging	Het
Serpinf1	T	A	11: 75,413,981	T185S	probably null	Het
Slc23a1	A	C	18: 35,625,851	C96G	possibly damaging	Het
Slc5a4a	C	T	10: 76,189,269		probably null	Het
Suco	A	T	1: 161,834,054	L936Q	probably damaging	Het
Tmem144	T	C	3: 79,825,299	Y224C	probably damaging	Het
Tpm4	T	A	8: 72,144,754		probably null	Het
Ttn	T	C	2: 76,730,070	E29329G	probably damaging	Het
Txn1	T	C	4: 57,943,922	I101V	probably benign	Het
Ube2o	A	T	11: 116,544,607	C452S	probably benign	Het
Uhrf1bp1l	T	C	10: 89,782,586	V141A	probably damaging	Het
Uxs1	A	T	1: 43,764,921	I278N	probably damaging	Het
Vps54	T	C	11: 21,306,519	F663L	probably damaging	Het
Wdfy3	CG	C	5: 101,926,525		probably null	Het
Zc3h11a	A	G	1: 133,621,701	S741P	probably damaging	Het
Zdhhc24	A	G	19: 4,878,951	N68S	probably damaging	Het
Znfx1	A	T	2: 167,044,066	L858*	probably null	Het

Other mutations in Zdbf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Zdbf2	APN	1	63306514	missense	possibly damaging	0.92
IGL00796:Zdbf2	APN	1	63307205	missense	probably benign	0.04
IGL00801:Zdbf2	APN	1	63303038	missense	possibly damaging	0.66
IGL02803:Zdbf2	APN	1	63303077	missense	possibly damaging	0.46
R0143:Zdbf2	UTSW	1	63308074	missense	probably benign	0.01
R0147:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0148:Zdbf2	UTSW	1	63304006	nonsense	probably null
R0433:Zdbf2	UTSW	1	63306143	missense	possibly damaging	0.46
R0502:Zdbf2	UTSW	1	63305290	missense	possibly damaging	0.66
R0645:Zdbf2	UTSW	1	63304950	missense	possibly damaging	0.81
R0765:Zdbf2	UTSW	1	63305723	missense	possibly damaging	0.46
R1068:Zdbf2	UTSW	1	63303430	missense	possibly damaging	0.94
R1216:Zdbf2	UTSW	1	63303002	missense	possibly damaging	0.83
R1235:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R1352:Zdbf2	UTSW	1	63303053	missense	probably damaging	0.96
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1402:Zdbf2	UTSW	1	63303627	missense	possibly damaging	0.46
R1435:Zdbf2	UTSW	1	63303040	missense	possibly damaging	0.66
R1562:Zdbf2	UTSW	1	63303588	missense	possibly damaging	0.83
R1624:Zdbf2	UTSW	1	63303859	missense	possibly damaging	0.66
R1635:Zdbf2	UTSW	1	63304334	missense	possibly damaging	0.92
R1644:Zdbf2	UTSW	1	63308972	missense	possibly damaging	0.66
R1662:Zdbf2	UTSW	1	63304249	nonsense	probably null
R1700:Zdbf2	UTSW	1	63302741	missense	unknown
R1853:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1854:Zdbf2	UTSW	1	63305542	frame shift	probably null
R1973:Zdbf2	UTSW	1	63309701	missense	unknown
R2336:Zdbf2	UTSW	1	63303464	missense	probably benign	0.00
R2428:Zdbf2	UTSW	1	63305615	missense	probably benign	0.04
R3010:Zdbf2	UTSW	1	63303065	missense	possibly damaging	0.92
R3034:Zdbf2	UTSW	1	63304205	missense	probably damaging	0.96
R3079:Zdbf2	UTSW	1	63307477	missense	probably benign	0.05
R3196:Zdbf2	UTSW	1	63308420	missense	possibly damaging	0.46
R3711:Zdbf2	UTSW	1	63308671	missense	possibly damaging	0.83
R3845:Zdbf2	UTSW	1	63308324	missense	possibly damaging	0.66
R4093:Zdbf2	UTSW	1	63309781	missense	possibly damaging	0.83
R4250:Zdbf2	UTSW	1	63302861	missense	possibly damaging	0.46
R4592:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R4721:Zdbf2	UTSW	1	63308792	missense	possibly damaging	0.46
R4779:Zdbf2	UTSW	1	63303238	missense	possibly damaging	0.66
R4928:Zdbf2	UTSW	1	63308814	missense	possibly damaging	0.81
R4943:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.92
R5025:Zdbf2	UTSW	1	63303650	missense	possibly damaging	0.82
R5095:Zdbf2	UTSW	1	63309073	missense	possibly damaging	0.66
R5149:Zdbf2	UTSW	1	63304903	missense	possibly damaging	0.83
R5326:Zdbf2	UTSW	1	63304411	missense	possibly damaging	0.66
R5341:Zdbf2	UTSW	1	63307933	missense	probably benign	0.27
R5511:Zdbf2	UTSW	1	63305677	missense	probably benign	0.03
R5809:Zdbf2	UTSW	1	63305876	missense	possibly damaging	0.90
R5902:Zdbf2	UTSW	1	63306526	missense	possibly damaging	0.83
R6162:Zdbf2	UTSW	1	63280818	start gained	probably benign
R6245:Zdbf2	UTSW	1	63304433	missense	possibly damaging	0.46
R6332:Zdbf2	UTSW	1	63307822	missense	possibly damaging	0.66
R6361:Zdbf2	UTSW	1	63303321	missense	possibly damaging	0.66
R6489:Zdbf2	UTSW	1	63307478	missense	possibly damaging	0.46
R6517:Zdbf2	UTSW	1	63305520	missense	possibly damaging	0.81
R6624:Zdbf2	UTSW	1	63303914	missense	possibly damaging	0.46
R6643:Zdbf2	UTSW	1	63304508	missense	possibly damaging	0.82
R6786:Zdbf2	UTSW	1	63304520	missense	possibly damaging	0.46
R6808:Zdbf2	UTSW	1	63308528	missense	possibly damaging	0.66
R6896:Zdbf2	UTSW	1	63308872	missense	probably damaging	0.98
R6997:Zdbf2	UTSW	1	63290766	missense	probably benign	0.09
R7011:Zdbf2	UTSW	1	63306766	missense	possibly damaging	0.66
R7058:Zdbf2	UTSW	1	63307404	missense	possibly damaging	0.66
R7066:Zdbf2	UTSW	1	63307559	missense	probably benign
R7177:Zdbf2	UTSW	1	63294961	missense	possibly damaging	0.94
R7184:Zdbf2	UTSW	1	63306505	missense	possibly damaging	0.92
R7273:Zdbf2	UTSW	1	63303404	missense	possibly damaging	0.90
R7387:Zdbf2	UTSW	1	63304039	missense	possibly damaging	0.46
R7468:Zdbf2	UTSW	1	63307510	missense	probably benign
R7695:Zdbf2	UTSW	1	63307370	missense	possibly damaging	0.83
R7712:Zdbf2	UTSW	1	63305371	missense	possibly damaging	0.83
R7735:Zdbf2	UTSW	1	63304105	missense	possibly damaging	0.66
R7736:Zdbf2	UTSW	1	63308007	nonsense	probably null
R7759:Zdbf2	UTSW	1	63308376	missense	possibly damaging	0.46
R7796:Zdbf2	UTSW	1	63303424	missense	possibly damaging	0.90
R7908:Zdbf2	UTSW	1	63306827	missense	possibly damaging	0.46
R7970:Zdbf2	UTSW	1	63304171	missense	possibly damaging	0.92
R8076:Zdbf2	UTSW	1	63306101	missense	possibly damaging	0.92
R8152:Zdbf2	UTSW	1	63306413	missense	possibly damaging	0.92
R8195:Zdbf2	UTSW	1	63304066	missense	possibly damaging	0.83
R8272:Zdbf2	UTSW	1	63305983	missense	probably benign
R8306:Zdbf2	UTSW	1	63304075	missense	possibly damaging	0.66
R8309:Zdbf2	UTSW	1	63306591	missense	possibly damaging	0.82
R8323:Zdbf2	UTSW	1	63302914	missense	possibly damaging	0.46
R8400:Zdbf2	UTSW	1	63304976	missense	possibly damaging	0.92
R8443:Zdbf2	UTSW	1	63306007	missense	possibly damaging	0.83
R8460:Zdbf2	UTSW	1	63309570	small deletion	probably benign
R8528:Zdbf2	UTSW	1	63303386	missense	possibly damaging	0.82
R8812:Zdbf2	UTSW	1	63308113	missense	probably benign	0.00
R8962:Zdbf2	UTSW	1	63308003	missense	probably benign	0.00
R9061:Zdbf2	UTSW	1	63307137	missense
R9072:Zdbf2	UTSW	1	63305764	missense	possibly damaging	0.83
R9232:Zdbf2	UTSW	1	63308009	missense	possibly damaging	0.66
R9257:Zdbf2	UTSW	1	63306241	missense	probably damaging	1.00
R9411:Zdbf2	UTSW	1	63304129	missense	probably damaging	0.97
R9470:Zdbf2	UTSW	1	63305625	missense	possibly damaging	0.82
R9606:Zdbf2	UTSW	1	63303377	missense	possibly damaging	0.92
R9621:Zdbf2	UTSW	1	63303476	missense	possibly damaging	0.66
RF021:Zdbf2	UTSW	1	63302652	missense	possibly damaging	0.82
X0018:Zdbf2	UTSW	1	63305351	missense	possibly damaging	0.92
X0027:Zdbf2	UTSW	1	63308007	nonsense	probably null
X0057:Zdbf2	UTSW	1	63305390	missense	possibly damaging	0.66
X0063:Zdbf2	UTSW	1	63305537	missense	probably benign	0.04
Z1176:Zdbf2	UTSW	1	63304245	missense	possibly damaging	0.83
Z1177:Zdbf2	UTSW	1	63304086	frame shift	probably null
Z1177:Zdbf2	UTSW	1	63309203	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGATTTGTAATGCTCCTGCCAGCTC -3'
(R):5'- TGCCTCACGACGCTTTGGAATG -3'

Sequencing Primer
(F):5'- TGCGGCTAACAGTGTTCC -3'
(R):5'- TTGGAATGGCACCTTCACG -3'

Posted On

2014-05-14