Incidental Mutation 'R0036:Ctsq'
ID201480
Institutional Source Beutler Lab
Gene Symbol Ctsq
Ensembl Gene ENSMUSG00000021439
Gene Namecathepsin Q
Synonyms1600010J02Rik
MMRRC Submission 038330-MU
Accession Numbers

Ncbi RefSeq: NM_029636.3; MGI:2137385

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0036 (G1)
Quality Score77
Status Validated
Chromosome13
Chromosomal Location61035024-61040631 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 61037671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021888] [ENSMUST00000021888] [ENSMUST00000021888]
Predicted Effect probably null
Transcript: ENSMUST00000021888
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021888
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Predicted Effect probably null
Transcript: ENSMUST00000021888
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144401
Meta Mutation Damage Score 0.9746 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Egln3 A T 12: 54,185,592 D142E possibly damaging Het
Fam120a G A 13: 48,889,264 probably benign Het
Hspg2 A G 4: 137,542,849 T2373A probably damaging Het
Pcyox1l G T 18: 61,697,421 T460K probably benign Het
Phrf1 T C 7: 141,261,780 M1435T probably damaging Het
Rnf157 A G 11: 116,396,302 Y32H probably damaging Het
Rnf224 C T 2: 25,236,131 R70Q probably damaging Het
Rusc2 C A 4: 43,424,009 D1054E probably damaging Het
S100a16 T A 3: 90,542,456 M82K probably benign Het
Serpina3j A G 12: 104,317,347 T235A probably benign Het
Sgo2a T C 1: 58,015,628 S324P probably benign Het
Slf1 G T 13: 77,100,951 Q373K probably benign Het
Son T A 16: 91,660,166 probably benign Het
Tril C T 6: 53,818,633 A535T probably benign Het
Vipr1 G A 9: 121,660,983 D141N probably benign Het
Other mutations in Ctsq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ctsq APN 13 61037714 missense probably damaging 0.96
IGL00585:Ctsq APN 13 61037127 missense probably benign 0.00
IGL00743:Ctsq APN 13 61036184 missense probably damaging 1.00
IGL00897:Ctsq APN 13 61037725 missense probably damaging 1.00
IGL01679:Ctsq APN 13 61038908 missense probably benign 0.00
IGL01982:Ctsq APN 13 61038918 missense probably benign
IGL01982:Ctsq APN 13 61039521 missense probably benign 0.05
IGL02448:Ctsq APN 13 61036230 missense probably damaging 1.00
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0741:Ctsq UTSW 13 61036205 missense probably damaging 0.99
R1192:Ctsq UTSW 13 61039045 missense probably damaging 1.00
R1593:Ctsq UTSW 13 61036172 splice site probably null
R3906:Ctsq UTSW 13 61038771 missense probably damaging 1.00
R4483:Ctsq UTSW 13 61038912 missense probably benign 0.01
R4590:Ctsq UTSW 13 61036214 missense probably benign 0.17
R5157:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5365:Ctsq UTSW 13 61037818 missense possibly damaging 0.95
R5366:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5546:Ctsq UTSW 13 61037888 nonsense probably null
R5595:Ctsq UTSW 13 61037060 missense probably benign 0.41
R6046:Ctsq UTSW 13 61039141 missense probably benign 0.00
R6049:Ctsq UTSW 13 61038758 critical splice donor site probably null
R6535:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R6537:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R7159:Ctsq UTSW 13 61038923 missense probably benign 0.00
R8189:Ctsq UTSW 13 61037155 missense probably damaging 1.00
Z1176:Ctsq UTSW 13 61037123 missense probably benign 0.01
Z1177:Ctsq UTSW 13 61037096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCACAAATCCTGTGATTTTAGCAGC -3'
(R):5'- ACTGATCCCACTGAGTGTACAGAACC -3'

Sequencing Primer
(F):5'- TTCCACTTACAGCCTGGAAG -3'
(R):5'- AACCTAGTGGACTGTTCTAGGC -3'
Posted On2014-06-13