Incidental Mutation 'R6537:Ctsq'
ID 520496
Institutional Source Beutler Lab
Gene Symbol Ctsq
Ensembl Gene ENSMUSG00000021439
Gene Name cathepsin Q
Synonyms 1600010J02Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029636.3; MGI:2137385

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R6537 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 61035024-61040631 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 61035326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 334 (I334N)
Ref Sequence ENSEMBL: ENSMUSP00000021888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021888]
AlphaFold Q91ZF4
Predicted Effect probably damaging
Transcript: ENSMUST00000021888
AA Change: I334N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439
AA Change: I334N

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144401
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (30/30)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc4 T C 5: 52,843,556 S224P probably damaging Het
Col6a4 G A 9: 106,067,954 T987M possibly damaging Het
Cort C T 4: 149,126,624 G8E probably benign Het
Ctdp1 G T 18: 80,449,551 D576E probably benign Het
Cwc15 A G 9: 14,501,988 D22G probably damaging Het
Dnmt3l G A 10: 78,052,064 G136R probably null Het
Fam19a2 T A 10: 123,593,496 M5K possibly damaging Het
Fxyd6 A G 9: 45,390,794 I37V possibly damaging Het
Gm10604 A C 4: 11,980,221 S28A unknown Het
Gm43302 A G 5: 105,290,995 I9T possibly damaging Het
Hmcn2 T C 2: 31,415,268 V3151A probably benign Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Kyat3 A G 3: 142,729,812 T282A probably benign Het
Lrp6 T C 6: 134,480,495 E782G probably benign Het
Lrrc3b T C 14: 15,357,946 Y220C probably damaging Het
Macf1 C T 4: 123,492,725 S1033N probably damaging Het
Mdm1 A G 10: 118,158,576 T452A probably benign Het
Nrn1l G T 8: 105,894,718 R99L probably damaging Het
Pappa T A 4: 65,297,282 I1142N probably damaging Het
Pcsk1 T C 13: 75,132,239 F728L probably damaging Het
Ptcd3 T C 6: 71,897,110 probably null Het
Siglecf C T 7: 43,355,999 T461I probably benign Het
Slc7a8 C T 14: 54,735,119 A282T probably benign Het
Srcap T C 7: 127,542,220 V1724A probably damaging Het
Tek A G 4: 94,837,324 Q609R probably benign Het
Trim45 C T 3: 100,925,396 A315V probably benign Het
Ttbk1 C T 17: 46,470,310 V446M probably damaging Het
Wrap53 T C 11: 69,563,868 D225G possibly damaging Het
Znhit6 A G 3: 145,594,619 I193V probably benign Het
Other mutations in Ctsq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ctsq APN 13 61037714 missense probably damaging 0.96
IGL00585:Ctsq APN 13 61037127 missense probably benign 0.00
IGL00743:Ctsq APN 13 61036184 missense probably damaging 1.00
IGL00897:Ctsq APN 13 61037725 missense probably damaging 1.00
IGL01679:Ctsq APN 13 61038908 missense probably benign 0.00
IGL01982:Ctsq APN 13 61038918 missense probably benign
IGL01982:Ctsq APN 13 61039521 missense probably benign 0.05
IGL02448:Ctsq APN 13 61036230 missense probably damaging 1.00
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0741:Ctsq UTSW 13 61036205 missense probably damaging 0.99
R1192:Ctsq UTSW 13 61039045 missense probably damaging 1.00
R1593:Ctsq UTSW 13 61036172 splice site probably null
R3906:Ctsq UTSW 13 61038771 missense probably damaging 1.00
R4483:Ctsq UTSW 13 61038912 missense probably benign 0.01
R4590:Ctsq UTSW 13 61036214 missense probably benign 0.17
R5157:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5365:Ctsq UTSW 13 61037818 missense possibly damaging 0.95
R5366:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5546:Ctsq UTSW 13 61037888 nonsense probably null
R5595:Ctsq UTSW 13 61037060 missense probably benign 0.41
R6046:Ctsq UTSW 13 61039141 missense probably benign 0.00
R6049:Ctsq UTSW 13 61038758 critical splice donor site probably null
R6535:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R7159:Ctsq UTSW 13 61038923 missense probably benign 0.00
R8189:Ctsq UTSW 13 61037155 missense probably damaging 1.00
R8890:Ctsq UTSW 13 61037688 missense probably damaging 1.00
Z1176:Ctsq UTSW 13 61037123 missense probably benign 0.01
Z1177:Ctsq UTSW 13 61037096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGCTCCCAGAATTCACATTAC -3'
(R):5'- CTGTAGTATTCACATCGTGGTTGAG -3'

Sequencing Primer
(F):5'- ACAATGTGGATTTTGTGGGACTCAAG -3'
(R):5'- GCACCTCTTGAACTCAGGAGTAG -3'
Posted On 2018-06-06