Incidental Mutation 'R1844:Ctss'
ID207519
Institutional Source Beutler Lab
Gene Symbol Ctss
Ensembl Gene ENSMUSG00000038642
Gene Namecathepsin S
SynonymsCat S
MMRRC Submission 039869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R1844 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95526786-95556403 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 95546794 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015667] [ENSMUST00000116304]
PDB Structure
[]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
MOUSE CATHEPSIN S WITH COVALENT LIGAND [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)-1-(PHENYLSULFONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Mouse cathepsin s with covalent ligand (3S,4S)-1-[(2-CHLOROPHENYL)SULFONYL]-N-[(2E)-2-IMINOETHYL]-4-(MORPHOLIN-4-YLCARBONYL)PYRROLIDINE-3-CARBOXAMIDE [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000015667
SMART Domains Protein: ENSMUSP00000015667
Gene: ENSMUSG00000038642

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Inhibitor_I29 39 99 2.3e-27 SMART
Pept_C1 126 342 2.3e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116304
SMART Domains Protein: ENSMUSP00000112006
Gene: ENSMUSG00000038642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Inhibitor_I29 36 96 3.01e-23 SMART
Pept_C1 123 339 6.79e-120 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, which encode preproproteins that are proteolytically processed to generate mature protein products. This enzyme is secreted by antigen-presenting cells during inflammation and may induce pain and itch via activation of G-protein coupled receptors. Homozygous knockout mice for this gene exhibit impaired wound healing, reduced tumorigenesis in a pancreatic cancer model, and reduced pathogenesis in a myasthenia gravis model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice are resistant to the development of experimental autoimmune myasthenia gravis and showed reduced T and B cell responses to acetylcholine receptor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik A T 7: 139,976,092 I212N probably benign Het
Aco1 A G 4: 40,197,566 K857E probably benign Het
Adam20 A G 8: 40,796,043 N397D probably benign Het
Adgrf3 T G 5: 30,199,213 D347A probably damaging Het
Ang6 C T 14: 44,001,873 E133K possibly damaging Het
Arhgap23 T A 11: 97,463,408 W205R probably damaging Het
Arhgef40 C A 14: 51,997,623 R1086S probably damaging Het
Atr G T 9: 95,905,817 A1488S probably benign Het
Cabin1 A T 10: 75,743,350 probably null Het
Cdh22 A C 2: 165,143,694 F324C probably damaging Het
Cep350 T C 1: 155,848,628 I3075V probably damaging Het
Chd9 A T 8: 90,956,695 K588* probably null Het
Clns1a A T 7: 97,696,859 I44F probably damaging Het
Colgalt1 T C 8: 71,611,351 I51T possibly damaging Het
Cpt2 C T 4: 107,904,255 E217K possibly damaging Het
Cyp1a1 A G 9: 57,702,697 T465A probably benign Het
Dbn1 A G 13: 55,481,347 probably null Het
Dennd1b A G 1: 139,090,405 probably null Het
Dnajc1 A C 2: 18,294,027 Y49* probably null Het
Dock10 T A 1: 80,543,201 I1188L probably damaging Het
Dsg1c T G 18: 20,283,039 probably null Het
Efcab6 G A 15: 83,967,621 T352I possibly damaging Het
Eps8l3 T C 3: 107,879,586 L26P possibly damaging Het
Fbxw26 A G 9: 109,724,878 V231A probably benign Het
Fetub G A 16: 22,935,669 E209K possibly damaging Het
Galc A T 12: 98,246,297 probably null Het
Gm6871 A T 7: 41,573,468 N65K probably benign Het
Gm8857 T C 5: 10,949,027 probably benign Het
Gstp3 A G 19: 4,057,540 I208T probably benign Het
Gtpbp3 A G 8: 71,492,628 Y448C probably benign Het
Hdac7 G T 15: 97,807,976 Q385K probably damaging Het
Hemgn C T 4: 46,396,655 V194M possibly damaging Het
Idh2 G C 7: 80,098,877 T113R probably benign Het
Jarid2 A C 13: 44,902,743 K336T possibly damaging Het
Kcnj4 C T 15: 79,485,015 V255M probably damaging Het
Ldhb C A 6: 142,494,208 W202L probably damaging Het
Lmbrd2 T A 15: 9,177,751 Y512* probably null Het
Lrp1 A G 10: 127,595,283 probably null Het
Map3k12 G A 15: 102,503,535 P365S probably damaging Het
Map3k5 G A 10: 20,104,163 D806N probably benign Het
Matn3 A G 12: 8,967,662 E438G possibly damaging Het
Mcmbp G A 7: 128,723,974 L97F probably damaging Het
Mmp3 A T 9: 7,453,662 I428L probably benign Het
Mphosph8 T C 14: 56,697,159 V855A probably damaging Het
Mycbp2 T A 14: 103,155,714 H3027L possibly damaging Het
Nbea C T 3: 56,082,436 R333H probably damaging Het
Notch1 G T 2: 26,460,434 H2231Q probably benign Het
Npas2 A T 1: 39,325,375 H266L probably damaging Het
Oas3 A G 5: 120,759,980 S833P probably damaging Het
Olfr1141 A C 2: 87,753,990 M1R probably null Het
Olfr344 T C 2: 36,568,777 Y60H probably damaging Het
Olfr808 G A 10: 129,767,856 R120H probably benign Het
Olfr994 T C 2: 85,429,921 T303A probably benign Het
Pak4 C T 7: 28,565,265 V71I possibly damaging Het
Pitpnm1 T C 19: 4,112,395 V1075A probably damaging Het
Pkp3 G A 7: 141,088,502 V555M probably damaging Het
Plekhm2 T C 4: 141,632,374 T381A probably benign Het
Plppr3 A G 10: 79,866,410 probably null Het
Ppp2r5e A T 12: 75,469,766 F216I possibly damaging Het
Ppp3ca T A 3: 136,921,911 V412D probably benign Het
Prss50 A G 9: 110,858,013 probably benign Het
Psph A C 5: 129,766,468 I174R probably damaging Het
Ptov1 A G 7: 44,865,567 Y207H possibly damaging Het
Ptprs A G 17: 56,434,510 S585P probably damaging Het
Rnf146 A T 10: 29,347,724 H55Q probably damaging Het
Rnf213 T A 11: 119,441,183 M2407K probably damaging Het
Rnls A C 19: 33,202,531 L55R possibly damaging Het
Rptor T C 11: 119,756,320 C246R probably damaging Het
Rrp12 C T 19: 41,877,783 probably null Het
Samd3 A G 10: 26,251,774 D223G probably damaging Het
Sdad1 G A 5: 92,305,296 Q68* probably null Het
Selenov G A 7: 28,290,422 T219M probably damaging Het
Shd A G 17: 55,971,554 D39G possibly damaging Het
Slc26a10 A T 10: 127,178,410 V245E probably damaging Het
Slit1 A G 19: 41,625,573 L820P probably damaging Het
Snap23 T C 2: 120,590,682 F96L probably benign Het
Spert C T 14: 75,583,410 V292I probably benign Het
Stkld1 A G 2: 26,950,103 H395R probably damaging Het
Syt13 G A 2: 92,940,820 G84D probably damaging Het
Terb2 T A 2: 122,186,509 L37Q probably damaging Het
Themis A G 10: 28,781,757 Y107C probably damaging Het
Top2a T A 11: 99,016,069 T249S probably benign Het
Tspo2 A T 17: 48,449,120 F71Y probably damaging Het
Ttc21b T A 2: 66,223,577 K753* probably null Het
Ttk A G 9: 83,854,862 Y458C possibly damaging Het
Ttn T C 2: 76,755,673 R21905G probably damaging Het
Ugt3a2 T A 15: 9,351,168 F88I probably benign Het
Vmn1r119 A G 7: 21,012,196 L87P probably damaging Het
Vmn1r36 A G 6: 66,716,763 F6L probably benign Het
Vmn2r15 T A 5: 109,286,994 K615* probably null Het
Wdr18 G A 10: 79,966,727 probably null Het
Wdr6 A T 9: 108,575,977 W236R probably damaging Het
Zbtb48 T C 4: 152,026,498 T187A probably benign Het
Other mutations in Ctss
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Ctss APN 3 95538725 missense probably damaging 1.00
IGL02162:Ctss APN 3 95546821 missense probably benign 0.26
IGL03026:Ctss APN 3 95538830 missense probably benign 0.01
IGL03219:Ctss APN 3 95543100 missense possibly damaging 0.88
clip UTSW 3 95545384 nonsense probably null
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0025:Ctss UTSW 3 95550137 missense probably damaging 1.00
R0033:Ctss UTSW 3 95545577 splice site probably benign
R0033:Ctss UTSW 3 95545577 splice site probably benign
R2866:Ctss UTSW 3 95545406 missense probably benign 0.04
R4061:Ctss UTSW 3 95543034 missense probably benign 0.34
R4846:Ctss UTSW 3 95545384 nonsense probably null
R5917:Ctss UTSW 3 95543113 missense probably benign 0.00
R6443:Ctss UTSW 3 95546803 missense probably benign 0.00
R6555:Ctss UTSW 3 95543029 nonsense probably null
R7391:Ctss UTSW 3 95529541 missense probably benign
R8007:Ctss UTSW 3 95550154 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGTCCAGCTTGAGTCAG -3'
(R):5'- TTACCGCTTTTGTAGAAGAAGAAGG -3'

Sequencing Primer
(F):5'- CCAGCTTGAGTCAGTGTTTACAAAC -3'
(R):5'- GAGGAATGGCTGGCGTC -3'
Posted On2014-06-23