Incidental Mutation 'R1847:Ncf4'
ID 207831
Institutional Source Beutler Lab
Gene Symbol Ncf4
Ensembl Gene ENSMUSG00000071715
Gene Name neutrophil cytosolic factor 4
Synonyms p40phox
MMRRC Submission 039872-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1847 (G1)
Quality Score 146
Status Validated
Chromosome 15
Chromosomal Location 78129001-78146780 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 78134582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 11 (S11R)
Ref Sequence ENSEMBL: ENSMUSP00000121191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096357] [ENSMUST00000133618]
AlphaFold P97369
Predicted Effect probably benign
Transcript: ENSMUST00000096357
AA Change: S11R

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000094084
Gene: ENSMUSG00000071715
AA Change: S11R

DomainStartEndE-ValueType
PX 18 136 3.16e-28 SMART
SH3 173 228 2.24e-19 SMART
PB1 237 329 8.06e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126028
Predicted Effect probably benign
Transcript: ENSMUST00000133618
AA Change: S11R

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121191
Gene: ENSMUSG00000071715
AA Change: S11R

DomainStartEndE-ValueType
PX 18 136 3.16e-28 SMART
SH3 173 228 2.24e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147303
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable but show impaired NADPH oxidase responses of neutrophils to a variety of stimuli and defective killing of S. aureus in vitro and in vivo. Homozygotes for a knock-in allele that prevents PtdIns3P binding to thePX domain fail in development prior to E10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 C A 16: 14,263,313 (GRCm39) R758S probably benign Het
Acnat1 A T 4: 49,447,716 (GRCm39) H288Q possibly damaging Het
Adamts1 T C 16: 85,599,114 (GRCm39) E162G possibly damaging Het
Akap11 A G 14: 78,751,101 (GRCm39) S429P probably benign Het
Alg14 T C 3: 121,155,415 (GRCm39) Y212H probably damaging Het
Cacna1g T C 11: 94,357,007 (GRCm39) T97A probably damaging Het
Ccdc112 T A 18: 46,420,821 (GRCm39) N310Y possibly damaging Het
Cenpl A T 1: 160,913,574 (GRCm39) Y328F probably damaging Het
Cep162 G A 9: 87,086,133 (GRCm39) H1064Y probably benign Het
Cnksr3 T A 10: 7,104,324 (GRCm39) E126D probably benign Het
Ctsh T A 9: 89,943,618 (GRCm39) M81K probably benign Het
D6Wsu163e A G 6: 126,932,112 (GRCm39) T284A probably damaging Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dnaaf1 T A 8: 120,309,616 (GRCm39) M196K probably benign Het
Dnah9 C A 11: 65,725,212 (GRCm39) G4314C probably damaging Het
Dph1 A G 11: 75,070,557 (GRCm39) Y361H probably damaging Het
Ect2 C T 3: 27,204,221 (GRCm39) M29I probably benign Het
Eif3h T C 15: 51,661,066 (GRCm39) Y167C probably damaging Het
Epc2 C T 2: 49,422,101 (GRCm39) R332C probably damaging Het
Fras1 C A 5: 96,897,282 (GRCm39) probably null Het
Gfm2 A G 13: 97,299,442 (GRCm39) I386V probably benign Het
Gpd1l G A 9: 114,743,399 (GRCm39) T167I probably damaging Het
Hsph1 T A 5: 149,546,950 (GRCm39) K567* probably null Het
Igfn1 T G 1: 135,897,126 (GRCm39) S1147R probably benign Het
Itgb4 T C 11: 115,874,590 (GRCm39) V406A probably benign Het
Kcna2 A G 3: 107,012,429 (GRCm39) I337V possibly damaging Het
Kcnab1 T C 3: 65,209,615 (GRCm39) probably null Het
Kri1 G T 9: 21,191,788 (GRCm39) probably benign Het
Lrguk T A 6: 34,110,322 (GRCm39) I801K possibly damaging Het
Magi2 A T 5: 20,807,458 (GRCm39) N871Y probably damaging Het
Map3k10 G T 7: 27,360,981 (GRCm39) probably null Het
Mrps25 T C 6: 92,155,721 (GRCm39) T71A probably damaging Het
Myo15a G A 11: 60,390,321 (GRCm39) W945* probably null Het
Ncan A T 8: 70,555,104 (GRCm39) I1021N probably damaging Het
Neb A C 2: 52,086,307 (GRCm39) S5255R possibly damaging Het
Nop2 TGATGAAGATGAAGATGA TGATGAAGATGA 6: 125,114,042 (GRCm39) probably benign Het
Or4c102 G A 2: 88,422,516 (GRCm39) A123T probably damaging Het
Or5ak22 A T 2: 85,230,785 (GRCm39) F31I probably damaging Het
Or5d16 T C 2: 87,773,065 (GRCm39) probably null Het
Pacs1 T C 19: 5,203,742 (GRCm39) I328V probably damaging Het
Pafah2 GCCCC GCCCCC 4: 134,152,852 (GRCm39) probably null Het
Pan2 A G 10: 128,140,247 (GRCm39) H56R possibly damaging Het
Pigo G A 4: 43,024,710 (GRCm39) R124* probably null Het
Ppfia2 A G 10: 106,763,571 (GRCm39) D1188G probably benign Het
Ppp1r16b A G 2: 158,603,355 (GRCm39) N327D probably damaging Het
Psd3 A G 8: 68,172,656 (GRCm39) C223R possibly damaging Het
Rad50 A G 11: 53,592,934 (GRCm39) V72A possibly damaging Het
Rcor3 T A 1: 191,785,133 (GRCm39) D445V possibly damaging Het
Rundc1 T A 11: 101,324,507 (GRCm39) H404Q probably benign Het
Ryr1 T C 7: 28,779,236 (GRCm39) K2083E probably benign Het
Scd3 C A 19: 44,224,281 (GRCm39) H171Q probably damaging Het
Scrn2 T C 11: 96,923,021 (GRCm39) F155L probably benign Het
Serpina12 A T 12: 103,998,769 (GRCm39) L323Q probably damaging Het
Sptlc3 T A 2: 139,467,843 (GRCm39) M467K probably benign Het
Stard9 G T 2: 120,528,970 (GRCm39) R1742S possibly damaging Het
Thbd A T 2: 148,249,604 (GRCm39) L88* probably null Het
Tln2 G A 9: 67,269,969 (GRCm39) Q477* probably null Het
Tnn T A 1: 159,943,752 (GRCm39) E1020D possibly damaging Het
Trip12 A T 1: 84,726,990 (GRCm39) H3Q probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,578,962 (GRCm39) probably benign Het
Vmp1 G A 11: 86,534,413 (GRCm39) Q165* probably null Het
Zfp758 T A 17: 22,594,204 (GRCm39) M230K probably benign Het
Other mutations in Ncf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Ncf4 APN 15 78,140,186 (GRCm39) missense probably damaging 1.00
IGL02546:Ncf4 APN 15 78,145,219 (GRCm39) missense probably damaging 1.00
IGL03064:Ncf4 APN 15 78,135,102 (GRCm39) missense probably damaging 1.00
IGL03407:Ncf4 APN 15 78,138,981 (GRCm39) splice site probably benign
R0281:Ncf4 UTSW 15 78,135,083 (GRCm39) missense probably damaging 0.96
R0378:Ncf4 UTSW 15 78,137,503 (GRCm39) missense probably damaging 0.98
R1513:Ncf4 UTSW 15 78,146,560 (GRCm39) missense probably benign
R1596:Ncf4 UTSW 15 78,134,637 (GRCm39) missense probably damaging 1.00
R1652:Ncf4 UTSW 15 78,145,234 (GRCm39) missense possibly damaging 0.83
R1815:Ncf4 UTSW 15 78,134,602 (GRCm39) missense probably benign 0.00
R1927:Ncf4 UTSW 15 78,144,846 (GRCm39) missense probably damaging 1.00
R2984:Ncf4 UTSW 15 78,146,520 (GRCm39) missense probably benign 0.09
R4302:Ncf4 UTSW 15 78,144,962 (GRCm39) unclassified probably benign
R4649:Ncf4 UTSW 15 78,140,189 (GRCm39) missense possibly damaging 0.61
R4905:Ncf4 UTSW 15 78,139,104 (GRCm39) missense probably damaging 0.99
R5114:Ncf4 UTSW 15 78,146,593 (GRCm39) unclassified probably benign
R5531:Ncf4 UTSW 15 78,144,988 (GRCm39) unclassified probably benign
R5799:Ncf4 UTSW 15 78,135,177 (GRCm39) missense probably benign 0.00
R7284:Ncf4 UTSW 15 78,144,902 (GRCm39) missense probably benign 0.01
R8193:Ncf4 UTSW 15 78,146,466 (GRCm39) missense probably damaging 1.00
R9447:Ncf4 UTSW 15 78,146,499 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGAAGCCAGCTGGTGACAC -3'
(R):5'- GCACCGCTGAATTCTATCCAGC -3'

Sequencing Primer
(F):5'- GGTGACACCAATTCCAGCTC -3'
(R):5'- CGCTGAATTCTATCCAGCAAATATC -3'
Posted On 2014-06-23