Incidental Mutation 'R2043:Cln5'
ID225240
Institutional Source Beutler Lab
Gene Symbol Cln5
Ensembl Gene ENSMUSG00000022125
Gene Nameceroid-lipofuscinosis, neuronal 5
SynonymsA730075N08Rik
MMRRC Submission 040050-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R2043 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location103070216-103077628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103075944 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 211 (S211P)
Ref Sequence ENSEMBL: ENSMUSP00000022721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022720] [ENSMUST00000022721]
Predicted Effect probably benign
Transcript: ENSMUST00000022720
SMART Domains Protein: ENSMUSP00000022720
Gene: ENSMUSG00000022124

DomainStartEndE-ValueType
FBOX 39 79 5.92e-7 SMART
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000022721
AA Change: S211P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022721
Gene: ENSMUSG00000022125
AA Change: S211P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:CLN5 34 332 9e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227117
Meta Mutation Damage Score 0.8836 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of eight which have been associated with neuronal ceroid lipofuscinoses (NCL). Also referred to as Batten disease, NCL comprises a class of autosomal recessive, neurodegenerative disorders affecting children. The genes responsible likely encode proteins involved in the degradation of post-translationally modified proteins in lysosomes. The primary defect in NCL disorders is thought to be associated with lysosomal storage function.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants showed loss of vision and accumulation of autofluorescent storage material in the central nervous system. Loss of a subset of GABAergic interneurons was seen in several brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A G 8: 24,996,653 probably null Het
Adnp2 A C 18: 80,128,326 M956R probably damaging Het
Aldh1l1 T A 6: 90,557,332 D36E probably benign Het
Ankmy1 T C 1: 92,876,527 probably benign Het
Apaf1 T C 10: 91,037,028 D718G probably damaging Het
Ascc3 C T 10: 50,700,520 P857L probably damaging Het
Atp8b1 T C 18: 64,605,200 K60R possibly damaging Het
Bub1 A T 2: 127,804,220 C947S probably damaging Het
Cacna1c C T 6: 118,596,088 G2017D probably benign Het
Capn3 A G 2: 120,491,901 N414S possibly damaging Het
Ccdc110 T C 8: 45,942,827 M585T probably benign Het
Cep85l A T 10: 53,358,128 N51K possibly damaging Het
Cftr T C 6: 18,320,935 F1415L probably benign Het
Dcaf5 A T 12: 80,340,217 D378E probably benign Het
Dhx57 A G 17: 80,253,080 probably benign Het
Dsn1 G A 2: 157,005,353 S55L possibly damaging Het
Eif5b T C 1: 38,041,819 F747S probably damaging Het
Fam189b A G 3: 89,185,567 Y251C probably damaging Het
Fbxo25 A G 8: 13,921,905 I86V probably damaging Het
Fpr-rs4 CAGGAA CA 17: 18,022,334 probably null Het
Glcci1 T A 6: 8,582,590 I130K probably damaging Het
Gm5424 A G 10: 62,071,211 noncoding transcript Het
Gsdma G A 11: 98,666,220 V54M possibly damaging Het
Heatr3 T A 8: 88,147,694 probably benign Het
Hist1h3c A G 13: 23,745,295 F68S probably damaging Het
Hspa13 A G 16: 75,758,268 L310S probably benign Het
Il6st A C 13: 112,480,219 Q100P probably benign Het
Ly6g6e G A 17: 35,077,864 R27Q possibly damaging Het
Mis18bp1 A T 12: 65,149,418 I524K probably damaging Het
Myo18a T C 11: 77,823,363 I761T probably damaging Het
Mypop T C 7: 19,001,019 probably benign Het
Olfr610 A G 7: 103,506,943 M1T probably null Het
Pcdh20 G A 14: 88,467,155 T903I probably benign Het
Pdk4 A T 6: 5,485,502 C396S probably benign Het
Piwil2 A G 14: 70,391,470 V699A probably benign Het
Plekha5 T C 6: 140,552,804 probably benign Het
Ralgapa1 T A 12: 55,677,026 I1572L probably damaging Het
Rasgrf2 T A 13: 92,030,843 M241L possibly damaging Het
Ryr1 C T 7: 29,059,631 R3374H probably damaging Het
Slc24a2 A T 4: 86,996,645 M519K probably damaging Het
Smg9 T A 7: 24,405,576 I67N possibly damaging Het
Spg20 G A 3: 55,127,548 A452T probably damaging Het
Ush2a T A 1: 188,916,256 F4686Y probably benign Het
Zfp146 T C 7: 30,162,239 K126R possibly damaging Het
Zfp386 T A 12: 116,059,161 D131E probably benign Het
Zfp423 T C 8: 87,782,618 D366G probably damaging Het
Zfp729a T C 13: 67,621,172 K313E probably damaging Het
Zfp955a G A 17: 33,242,553 H202Y possibly damaging Het
Other mutations in Cln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Cln5 APN 14 103076032 missense possibly damaging 0.64
IGL02218:Cln5 APN 14 103075840 unclassified probably null
PIT4480001:Cln5 UTSW 14 103071778 nonsense probably null
R0649:Cln5 UTSW 14 103071761 missense probably benign
R2313:Cln5 UTSW 14 103071746 nonsense probably null
R3829:Cln5 UTSW 14 103073359 missense probably damaging 0.97
R5486:Cln5 UTSW 14 103076194 missense probably damaging 0.98
R6265:Cln5 UTSW 14 103073227 missense probably damaging 1.00
R6361:Cln5 UTSW 14 103076201 missense probably benign 0.05
R7361:Cln5 UTSW 14 103075903 missense probably damaging 1.00
R7869:Cln5 UTSW 14 103076065 missense probably damaging 1.00
R7952:Cln5 UTSW 14 103076065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGTCTTAATGGCATTGGAAC -3'
(R):5'- AAATACGGTCTGAAGGGGCC -3'

Sequencing Primer
(F):5'- ATGGCATTGGAACTTTTTATAAACAG -3'
(R):5'- ATGGCCAAAGCAAGAGTCTTGTTTC -3'
Posted On2014-08-25