Incidental Mutation 'R2150:Themis'
ID234205
Institutional Source Beutler Lab
Gene Symbol Themis
Ensembl Gene ENSMUSG00000049109
Gene Namethymocyte selection associated
SynonymsTsepa, Gasp, E430004N04Rik
MMRRC Submission 040153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R2150 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28668360-28883818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28668727 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 23 (I23N)
Ref Sequence ENSEMBL: ENSMUSP00000101155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056097] [ENSMUST00000060409] [ENSMUST00000105516] [ENSMUST00000159927] [ENSMUST00000161345] [ENSMUST00000162202]
Predicted Effect probably damaging
Transcript: ENSMUST00000056097
AA Change: I23N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060129
Gene: ENSMUSG00000049109
AA Change: I23N

DomainStartEndE-ValueType
Pfam:CABIT 17 266 5.2e-59 PFAM
Pfam:CABIT 282 530 3.7e-48 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000060409
AA Change: I23N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055315
Gene: ENSMUSG00000049109
AA Change: I23N

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9.3e-52 PFAM
Pfam:CABIT 282 532 5e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105516
AA Change: I23N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101155
Gene: ENSMUSG00000049109
AA Change: I23N

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9e-52 PFAM
Pfam:CABIT 282 532 4.9e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159927
AA Change: I23N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123919
Gene: ENSMUSG00000049109
AA Change: I23N

DomainStartEndE-ValueType
Pfam:CABIT 17 91 1.9e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161345
AA Change: I23N
SMART Domains Protein: ENSMUSP00000123894
Gene: ENSMUSG00000049109
AA Change: I23N

DomainStartEndE-ValueType
Pfam:CABIT 17 86 1.9e-9 PFAM
Pfam:CABIT 129 203 5.1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162202
AA Change: I23N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124451
Gene: ENSMUSG00000049109
AA Change: I23N

DomainStartEndE-ValueType
Pfam:CABIT 17 91 1.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162343
Meta Mutation Damage Score 0.9064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a protein that plays a regulatory role in both positive and negative T-cell selection during late thymocyte development. The protein functions through T-cell antigen receptor signaling, and is necessary for proper lineage commitment and maturation of T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mice have defects in T cell positive selection that leads to very few alpha-beta T cells being found in the periphery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402J07Rik C T 8: 87,586,063 Q159* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adam34 A G 8: 43,652,501 Y36H probably benign Het
Adprm A G 11: 67,038,229 V312A probably benign Het
Anapc2 T C 2: 25,272,670 L52P probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apoc4 T A 7: 19,678,635 T62S probably damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap32 A G 9: 32,116,140 E2G possibly damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc63 C G 5: 122,127,565 A71P possibly damaging Het
Cdca2 T C 14: 67,714,809 K38E probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dab2 T C 15: 6,416,917 V5A probably benign Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Disp1 A G 1: 183,088,372 F828S probably damaging Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dock2 A G 11: 34,229,472 probably null Het
Dsel A T 1: 111,860,257 N849K probably benign Het
Fah A T 7: 84,594,834 I239N probably damaging Het
Flt4 T C 11: 49,645,997 Y1265H probably benign Het
Ghdc T C 11: 100,769,192 E243G probably benign Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm6619 A G 6: 131,489,058 I40V probably benign Het
Gpld1 T C 13: 24,962,647 V225A probably benign Het
Hectd4 T C 5: 121,253,858 probably benign Het
Igdcc4 A G 9: 65,125,335 I542V possibly damaging Het
Igsf9b T C 9: 27,334,337 L1200P probably damaging Het
Itgb7 C T 15: 102,222,118 V378M probably damaging Het
Krt84 T C 15: 101,529,584 E312G possibly damaging Het
Man2a2 A G 7: 80,367,784 W250R probably damaging Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mgat5 T C 1: 127,469,250 V578A probably damaging Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh1 A C 11: 67,222,408 D1873A probably benign Het
Nek9 A G 12: 85,329,903 W235R probably damaging Het
Olfr1013 T C 2: 85,769,998 S66P probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pecr T C 1: 72,277,358 R63G possibly damaging Het
Pkhd1l1 T G 15: 44,499,982 probably null Het
Plekha5 T C 6: 140,570,403 V270A probably damaging Het
Prr14l T C 5: 32,830,702 D483G probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Senp1 C T 15: 98,058,315 V408I possibly damaging Het
Stambpl1 T A 19: 34,226,704 Y65N probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Thnsl1 T C 2: 21,212,533 I366T probably benign Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tmem178b A T 6: 40,207,501 Q111L probably damaging Het
Vmn1r195 C G 13: 22,278,764 L135V possibly damaging Het
Vmn2r-ps36 C T 7: 7,428,540 noncoding transcript Het
Zfp956 G A 6: 47,963,871 R388H probably damaging Het
Zfr2 T G 10: 81,242,116 V259G probably benign Het
Other mutations in Themis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Themis APN 10 28668753 splice site probably benign
IGL01729:Themis APN 10 28761591 nonsense probably null
IGL01833:Themis APN 10 28782311 nonsense probably null
IGL02582:Themis APN 10 28761547 missense probably benign 0.00
IGL02835:Themis APN 10 28761620 intron probably benign
cloudies UTSW 10 28761199 nonsense probably null
currant UTSW 10 28782011 missense probably damaging 1.00
death_valley UTSW 10 28668727 missense probably damaging 1.00
Meteor UTSW 10 28781832 missense possibly damaging 0.90
six_flags UTSW 10 28781907 missense probably damaging 1.00
R0445:Themis UTSW 10 28782011 missense probably damaging 1.00
R0507:Themis UTSW 10 28781832 missense possibly damaging 0.90
R0709:Themis UTSW 10 28761574 missense probably benign 0.00
R1170:Themis UTSW 10 28668748 missense possibly damaging 0.80
R1442:Themis UTSW 10 28782135 missense probably damaging 0.96
R1844:Themis UTSW 10 28781757 missense probably damaging 1.00
R2004:Themis UTSW 10 28782724 missense probably benign 0.28
R2358:Themis UTSW 10 28863380 missense possibly damaging 0.57
R4529:Themis UTSW 10 28782335 missense possibly damaging 0.92
R4693:Themis UTSW 10 28782651 missense probably damaging 1.00
R4717:Themis UTSW 10 28789752 missense probably benign
R4801:Themis UTSW 10 28761511 missense probably benign 0.21
R4802:Themis UTSW 10 28761511 missense probably benign 0.21
R5249:Themis UTSW 10 28761199 nonsense probably null
R5557:Themis UTSW 10 28781886 missense possibly damaging 0.90
R5569:Themis UTSW 10 28781891 missense possibly damaging 0.95
R5640:Themis UTSW 10 28863376 missense probably damaging 0.99
R5735:Themis UTSW 10 28722534 missense probably benign 0.09
R6467:Themis UTSW 10 28781766 missense possibly damaging 0.47
R6523:Themis UTSW 10 28781898 missense possibly damaging 0.65
R6727:Themis UTSW 10 28781907 missense probably damaging 1.00
R7014:Themis UTSW 10 28789707 missense probably benign
R7101:Themis UTSW 10 28761426 nonsense probably null
R7185:Themis UTSW 10 28781877 missense probably benign 0.00
R7323:Themis UTSW 10 28733501 missense probably benign
R7386:Themis UTSW 10 28789747 missense probably benign 0.00
R7472:Themis UTSW 10 28761419 missense possibly damaging 0.69
R7555:Themis UTSW 10 28781702 missense possibly damaging 0.67
R7715:Themis UTSW 10 28863309 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGTACCTCCCCACCTTAGG -3'
(R):5'- ACAACTTGCACTTTGTTTGCTG -3'

Sequencing Primer
(F):5'- CATTTCACATTCTGCCTGTGTGGG -3'
(R):5'- CTGGGTGTGTATATGTTTGAACTAAG -3'
Posted On2014-10-01