Incidental Mutation 'R2203:Gapdh'
ID238834
Institutional Source Beutler Lab
Gene Symbol Gapdh
Ensembl Gene ENSMUSG00000057666
Gene Nameglyceraldehyde-3-phosphate dehydrogenase
SynonymsGapd, Gapd
MMRRC Submission 040205-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2203 (G1)
Quality Score144
Status Not validated
Chromosome6
Chromosomal Location125161715-125166467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 125162606 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 165 (S165T)
Ref Sequence ENSEMBL: ENSMUSP00000138508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073605] [ENSMUST00000117675] [ENSMUST00000117757] [ENSMUST00000118875] [ENSMUST00000119527] [ENSMUST00000144364] [ENSMUST00000182052] [ENSMUST00000182277] [ENSMUST00000183272]
Predicted Effect probably benign
Transcript: ENSMUST00000073605
AA Change: S208T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073289
Gene: ENSMUSG00000057666
AA Change: S208T

DomainStartEndE-ValueType
Gp_dh_N 2 143 4.2e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117757
AA Change: S234T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113942
Gene: ENSMUSG00000057666
AA Change: S234T

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 5.2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118875
AA Change: S208T

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113213
Gene: ENSMUSG00000057666
AA Change: S208T

DomainStartEndE-ValueType
Gp_dh_N 2 150 7.33e-109 SMART
Pfam:Gp_dh_C 155 312 7.4e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144205
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147954
Predicted Effect probably benign
Transcript: ENSMUST00000148835
SMART Domains Protein: ENSMUSP00000115080
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
Filament 34 348 4.99e-2 SMART
low complexity region 356 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150474
Predicted Effect probably benign
Transcript: ENSMUST00000182052
SMART Domains Protein: ENSMUSP00000138403
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 1 55 2.96e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182115
Predicted Effect probably benign
Transcript: ENSMUST00000182277
SMART Domains Protein: ENSMUSP00000138295
Gene: ENSMUSG00000057666

DomainStartEndE-ValueType
Gp_dh_N 2 57 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182670
Predicted Effect probably benign
Transcript: ENSMUST00000183272
AA Change: S165T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138508
Gene: ENSMUSG00000057666
AA Change: S165T

DomainStartEndE-ValueType
Gp_dh_N 2 107 7.93e-64 SMART
Pfam:Gp_dh_C 112 269 3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192506
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein was originally identified as a key glycolytic enzyme that converts D-glyceraldehyde 3-phosphate (G3P) into 3-phospho-D-glyceroyl phosphate. Subsequent studies have assigned a variety of additional functions to the protein including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Alternative splicing results in multiple transcript variants. Many pseudogenes similar to this locus are found throughout the mouse genome. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mutant heterozygotes show reduced enzyme levels. The currently known mutant allels are homozygous lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik C T 3: 108,475,043 G270E probably damaging Het
Abca1 G A 4: 53,090,291 T386I probably damaging Het
Abcc5 C G 16: 20,405,882 L44F possibly damaging Het
Abi3bp T G 16: 56,613,203 L550R probably benign Het
Brca2 T A 5: 150,539,502 D910E possibly damaging Het
Cacna1h C T 17: 25,380,260 A1742T probably damaging Het
Cartpt A T 13: 99,900,625 S4T probably benign Het
Ccdc66 T A 14: 27,486,833 D488V probably benign Het
Cdan1 C A 2: 120,720,760 C1093F probably damaging Het
Cfap45 T C 1: 172,532,161 V76A probably benign Het
Clptm1 G T 7: 19,633,892 F598L possibly damaging Het
Cntrl G A 2: 35,143,737 V257I possibly damaging Het
Cpa1 A G 6: 30,641,819 D214G probably damaging Het
Crebbp A C 16: 4,138,777 M394R possibly damaging Het
Ctnnd1 A G 2: 84,616,680 L407P probably damaging Het
Cttnbp2 T G 6: 18,408,694 D976A probably benign Het
Dicer1 C T 12: 104,731,038 V87M probably damaging Het
Fam184a T A 10: 53,652,434 Q29L probably damaging Het
Flnc C T 6: 29,459,508 P2536S probably damaging Het
Gm6370 T A 5: 146,493,729 D241E probably benign Het
Grik4 T A 9: 42,547,655 S596C probably damaging Het
Gtf2e1 T A 16: 37,511,542 E390D possibly damaging Het
Hmgcr A G 13: 96,656,633 L497P probably damaging Het
Hmgcs2 T A 3: 98,291,183 I134N probably damaging Het
Htr5b T C 1: 121,527,964 T76A probably damaging Het
Iars A G 13: 49,722,675 E812G probably benign Het
Ints8 A T 4: 11,225,712 M615K possibly damaging Het
Jmjd1c A G 10: 67,239,463 probably null Het
Kcnj5 T C 9: 32,322,900 T40A probably benign Het
Knstrn T A 2: 118,830,975 probably null Het
Map2k2 T C 10: 81,119,379 S14P probably damaging Het
Med26 T C 8: 72,495,902 E451G probably damaging Het
Nbeal1 T A 1: 60,284,006 M2081K probably benign Het
Nectin4 G A 1: 171,386,229 V433M possibly damaging Het
Nop56 T A 2: 130,277,568 I51N probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nudt5 A T 2: 5,855,983 I22F possibly damaging Het
Olfr1198 C G 2: 88,746,609 G93A probably benign Het
Pbrm1 A G 14: 31,032,449 D142G possibly damaging Het
Pdcl A T 2: 37,352,044 N231K probably benign Het
Pkd1 G T 17: 24,580,889 A591S probably benign Het
Plcb4 T C 2: 136,002,594 I144T probably benign Het
Prrc2b C A 2: 32,223,464 Q1970K probably damaging Het
Rabep1 A C 11: 70,934,574 E689A probably damaging Het
Ralgapa1 T C 12: 55,612,800 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Saxo1 A C 4: 86,445,761 Y162D probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l2 A T 8: 125,491,627 W324R probably damaging Het
Slc19a1 T C 10: 77,041,924 C98R possibly damaging Het
Slc26a8 G T 17: 28,648,007 L583I probably benign Het
Spata31d1d A G 13: 59,731,621 C34R possibly damaging Het
Stoml2 G T 4: 43,030,243 Y119* probably null Het
Susd1 A G 4: 59,349,843 L531P possibly damaging Het
Tnfsf14 T C 17: 57,190,638 D198G possibly damaging Het
Ttc39a A G 4: 109,431,588 N293S probably benign Het
Ttn T C 2: 76,771,641 N18559S possibly damaging Het
Vmn2r104 A T 17: 20,029,821 N729K probably benign Het
Zfp651 A G 9: 121,762,637 T8A possibly damaging Het
Zfp712 T A 13: 67,041,984 T160S probably benign Het
Other mutations in Gapdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Gapdh APN 6 125162507 missense probably damaging 0.99
R3195:Gapdh UTSW 6 125162620 missense possibly damaging 0.94
R4181:Gapdh UTSW 6 125165234 intron probably benign
R4480:Gapdh UTSW 6 125163182 missense possibly damaging 0.55
R5934:Gapdh UTSW 6 125162701 missense probably damaging 0.98
R6019:Gapdh UTSW 6 125163033 nonsense probably null
R6034:Gapdh UTSW 6 125165298 missense probably benign 0.25
R6212:Gapdh UTSW 6 125162698 missense probably damaging 1.00
R6776:Gapdh UTSW 6 125162273 missense probably damaging 1.00
R6928:Gapdh UTSW 6 125162671 missense probably damaging 1.00
R7188:Gapdh UTSW 6 125165440 intron probably benign
R7330:Gapdh UTSW 6 125162937 missense probably benign 0.03
R7777:Gapdh UTSW 6 125162948 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCCCAAGTCACTGTCACAC -3'
(R):5'- GGGGAGACAGCTCATGCATTTC -3'

Sequencing Primer
(F):5'- GTCACTGTCACACCAGAGAC -3'
(R):5'- GGGAGACAGCTCATGCATTTCTTATC -3'
Posted On2014-10-02