Incidental Mutation 'R2301:Catsper1'
ID244441
Institutional Source Beutler Lab
Gene Symbol Catsper1
Ensembl Gene ENSMUSG00000038498
Gene Namecation channel, sperm associated 1
SynonymsKSper
MMRRC Submission 040300-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2301 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5335741-5344153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5340398 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 602 (K602E)
Ref Sequence ENSEMBL: ENSMUSP00000045430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025764] [ENSMUST00000043380]
Predicted Effect probably benign
Transcript: ENSMUST00000025764
SMART Domains Protein: ENSMUSP00000025764
Gene: ENSMUSG00000024846

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CY 33 147 2.36e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043380
AA Change: K602E

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045430
Gene: ENSMUSG00000038498
AA Change: K602E

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
low complexity region 128 141 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 230 242 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
low complexity region 308 321 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Pfam:Ion_trans 350 584 1.7e-34 PFAM
Pfam:PKD_channel 439 583 6.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium ions play a primary role in the regulation of sperm motility. This gene belongs to a family of putative cation channels that are specific to spermatozoa and localize to the flagellum. The protein family features a single repeat with six membrane-spanning segments and a predicted calcium-selective pore region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit sperm with markedly decreased motility that are unable to fertilize ova and lack a calcium ion influx response to cyclic-AMP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Chst13 A T 6: 90,318,289 S47R probably damaging Het
Clrn1 T G 3: 58,846,352 Y196S probably damaging Het
Csmd3 A G 15: 47,731,998 S2022P probably damaging Het
Dnhd1 T A 7: 105,705,399 F3123I probably damaging Het
Dpp9 C T 17: 56,194,973 E532K probably benign Het
Eif4g3 T A 4: 138,172,659 D970E probably damaging Het
Fam222b T C 11: 78,154,543 V310A probably damaging Het
Gm16380 A G 9: 53,884,200 noncoding transcript Het
Gtf2a1l G T 17: 88,711,472 R328L probably benign Het
Hectd4 T A 5: 121,353,537 F3679L probably benign Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Klf10 A G 15: 38,297,082 V223A possibly damaging Het
Lyn G A 4: 3,780,959 R345H probably damaging Het
Med13l T A 5: 118,593,447 C63S probably damaging Het
Nlrp1a T C 11: 71,106,101 T960A possibly damaging Het
Ogfod1 C T 8: 94,037,368 S27L probably damaging Het
Olfr1301 T A 2: 111,754,276 V9E probably benign Het
Pcdha1 A G 18: 37,156,183 Y864C probably damaging Het
Pkd1 A G 17: 24,574,612 K1758E probably benign Het
Polk T C 13: 96,484,144 E516G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Sptbn2 G A 19: 4,734,138 R636Q probably benign Het
Tmem139 G T 6: 42,263,430 C57F possibly damaging Het
Traf5 T C 1: 191,997,965 N375S probably benign Het
Tti2 T C 8: 31,155,795 V379A probably benign Het
Zfp106 T C 2: 120,535,650 E92G probably benign Het
Other mutations in Catsper1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Catsper1 APN 19 5337772 missense probably damaging 1.00
IGL01361:Catsper1 APN 19 5339479 missense probably damaging 1.00
IGL02413:Catsper1 APN 19 5336236 missense possibly damaging 0.46
IGL02560:Catsper1 APN 19 5336188 missense possibly damaging 0.93
IGL03335:Catsper1 APN 19 5336311 missense probably damaging 0.97
R0002:Catsper1 UTSW 19 5341523 splice site probably benign
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0164:Catsper1 UTSW 19 5339475 missense possibly damaging 0.93
R0324:Catsper1 UTSW 19 5336545 missense probably damaging 0.99
R1782:Catsper1 UTSW 19 5335909 missense probably benign 0.01
R3864:Catsper1 UTSW 19 5336176 missense possibly damaging 0.93
R4808:Catsper1 UTSW 19 5344136 missense possibly damaging 0.76
R4941:Catsper1 UTSW 19 5341438 missense possibly damaging 0.90
R4983:Catsper1 UTSW 19 5335963 missense probably benign 0.26
R5072:Catsper1 UTSW 19 5340046 unclassified probably null
R5077:Catsper1 UTSW 19 5335970 missense probably damaging 0.99
R5629:Catsper1 UTSW 19 5336137 missense probably benign 0.00
R6402:Catsper1 UTSW 19 5339496 missense probably damaging 1.00
R6875:Catsper1 UTSW 19 5343963 missense probably damaging 0.99
R7368:Catsper1 UTSW 19 5336663 missense unknown
R7510:Catsper1 UTSW 19 5339550 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAGTATGTGGCCTCTTCTCTGG -3'
(R):5'- TAGAGGACTGTCTAGAATCCTTTGG -3'

Sequencing Primer
(F):5'- CCTCTGCAGCCTGGTGATTG -3'
(R):5'- GTCTAGAATCCTTTGGCTCAAAGTTC -3'
Posted On2014-10-30