Incidental Mutation 'R2303:Sema3g'
ID244506
Institutional Source Beutler Lab
Gene Symbol Sema3g
Ensembl Gene ENSMUSG00000021904
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G
Synonyms
MMRRC Submission 040302-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2303 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31217860-31230352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31222615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 329 (F329L)
Ref Sequence ENSEMBL: ENSMUSP00000087643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090180]
Predicted Effect probably damaging
Transcript: ENSMUST00000090180
AA Change: F329L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087643
Gene: ENSMUSG00000021904
AA Change: F329L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 503 2.96e-184 SMART
PSI 521 574 3.2e-11 SMART
IG 588 674 6.41e-2 SMART
Meta Mutation Damage Score 0.9059 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transcription of this gene is activated by PPAR-gamma, and the resulting protein product plays a role in endothelial cell migration. Expression of this gene also inhibits tumor cell migration and invasion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lymphatic branching complexity with decreased lymphatic width. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T G 17: 64,834,566 D14A unknown Het
Aars C A 8: 111,052,502 T756K possibly damaging Het
Abca9 A T 11: 110,158,226 M252K probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Arid1a C A 4: 133,687,251 R1223L unknown Het
Ash1l T C 3: 89,026,426 L2003S probably damaging Het
Cct8 A T 16: 87,490,332 probably null Het
Dagla T C 19: 10,252,103 T598A probably damaging Het
Ercc3 A G 18: 32,245,547 I194V probably benign Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fn1 C T 1: 71,614,036 probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gnrhr C T 5: 86,197,749 G26D probably benign Het
Hmcn1 A T 1: 150,704,226 L1920Q probably damaging Het
Kank2 T A 9: 21,769,765 I823F probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Mfsd6 T A 1: 52,676,513 N535I probably damaging Het
Mgat5 T C 1: 127,446,299 Y479H probably benign Het
Ncoa7 G A 10: 30,654,435 T701I probably damaging Het
Olfr791 T C 10: 129,527,049 V274A probably benign Het
Pcdh18 T C 3: 49,755,274 R531G probably damaging Het
Pcdhb6 A G 18: 37,336,231 H51R probably damaging Het
Pdik1l G A 4: 134,284,248 Q95* probably null Het
Ppp4r3b A T 11: 29,200,741 H469L possibly damaging Het
Prnp A G 2: 131,937,126 T233A probably benign Het
Rcan1 T C 16: 92,393,596 T152A possibly damaging Het
Setd1a G A 7: 127,799,155 probably benign Het
Slc40a1 G A 1: 45,910,884 probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Spg11 C T 2: 122,068,837 C1589Y probably damaging Het
Stab1 T C 14: 31,146,070 T1616A probably damaging Het
Trappc11 A G 8: 47,503,416 Y842H probably damaging Het
Vwde T A 6: 13,215,807 probably benign Het
Zcchc8 A G 5: 123,700,597 L626P probably benign Het
Zfhx4 A G 3: 5,397,060 H1240R probably damaging Het
Other mutations in Sema3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Sema3g APN 14 31221727 missense probably damaging 1.00
IGL01650:Sema3g APN 14 31221787 missense probably benign 0.00
IGL01782:Sema3g APN 14 31227791 missense probably damaging 1.00
IGL01784:Sema3g APN 14 31222967 missense probably damaging 1.00
IGL01869:Sema3g APN 14 31223667 missense probably damaging 1.00
IGL01999:Sema3g APN 14 31217965 missense probably benign
IGL02095:Sema3g APN 14 31227824 missense probably benign 0.00
IGL02232:Sema3g APN 14 31221224 missense probably damaging 1.00
IGL02477:Sema3g APN 14 31227866 missense probably damaging 0.98
IGL02583:Sema3g APN 14 31221519 critical splice acceptor site probably null
R0791:Sema3g UTSW 14 31220904 splice site probably benign
R1225:Sema3g UTSW 14 31220679 missense probably damaging 1.00
R1471:Sema3g UTSW 14 31228045 missense probably damaging 1.00
R3968:Sema3g UTSW 14 31226521 critical splice donor site probably null
R3970:Sema3g UTSW 14 31226521 critical splice donor site probably null
R4406:Sema3g UTSW 14 31228159 missense probably benign 0.01
R4773:Sema3g UTSW 14 31220709 missense probably benign 0.04
RF021:Sema3g UTSW 14 31227841 missense probably damaging 1.00
X0013:Sema3g UTSW 14 31222111 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GACTCACTTTGACCAGCTAGG -3'
(R):5'- TGACAGTGGCTGCTGAAAAC -3'

Sequencing Primer
(F):5'- CTAGGTAAGGGAATGGCCAACC -3'
(R):5'- TGGCTGCTGAAAACAAAGATTG -3'
Posted On2014-10-30