Incidental Mutation 'R2303:Trappc11'
ID244496
Institutional Source Beutler Lab
Gene Symbol Trappc11
Ensembl Gene ENSMUSG00000038102
Gene Nametrafficking protein particle complex 11
SynonymsD030016E14Rik
MMRRC Submission 040302-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2303 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location47490115-47533470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47503416 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 842 (Y842H)
Ref Sequence ENSEMBL: ENSMUSP00000047562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039061] [ENSMUST00000120987]
Predicted Effect probably damaging
Transcript: ENSMUST00000039061
AA Change: Y842H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: Y842H

DomainStartEndE-ValueType
Pfam:Foie-gras_1 263 522 3e-78 PFAM
Pfam:Gryzun 978 1114 3.9e-10 PFAM
Pfam:Gryzun-like 1036 1095 2.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120987
SMART Domains Protein: ENSMUSP00000113779
Gene: ENSMUSG00000038102

DomainStartEndE-ValueType
Pfam:Gryzun 1 155 4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125065
Meta Mutation Damage Score 0.3996 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930583I09Rik T G 17: 64,834,566 D14A unknown Het
Aars C A 8: 111,052,502 T756K possibly damaging Het
Abca9 A T 11: 110,158,226 M252K probably benign Het
Acan A G 7: 79,099,957 E1492G probably benign Het
Arid1a C A 4: 133,687,251 R1223L unknown Het
Ash1l T C 3: 89,026,426 L2003S probably damaging Het
Cct8 A T 16: 87,490,332 probably null Het
Dagla T C 19: 10,252,103 T598A probably damaging Het
Ercc3 A G 18: 32,245,547 I194V probably benign Het
Fbxo46 A G 7: 19,136,616 N387D possibly damaging Het
Fn1 C T 1: 71,614,036 probably null Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gnrhr C T 5: 86,197,749 G26D probably benign Het
Hmcn1 A T 1: 150,704,226 L1920Q probably damaging Het
Kank2 T A 9: 21,769,765 I823F probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kdm1b TCATTGTCC TCATTGTCCATTGTCC 13: 47,064,088 probably null Het
Mfsd6 T A 1: 52,676,513 N535I probably damaging Het
Mgat5 T C 1: 127,446,299 Y479H probably benign Het
Ncoa7 G A 10: 30,654,435 T701I probably damaging Het
Olfr791 T C 10: 129,527,049 V274A probably benign Het
Pcdh18 T C 3: 49,755,274 R531G probably damaging Het
Pcdhb6 A G 18: 37,336,231 H51R probably damaging Het
Pdik1l G A 4: 134,284,248 Q95* probably null Het
Ppp4r3b A T 11: 29,200,741 H469L possibly damaging Het
Prnp A G 2: 131,937,126 T233A probably benign Het
Rcan1 T C 16: 92,393,596 T152A possibly damaging Het
Sema3g T C 14: 31,222,615 F329L probably damaging Het
Setd1a G A 7: 127,799,155 probably benign Het
Slc40a1 G A 1: 45,910,884 probably benign Het
Slco5a1 C T 1: 12,879,262 G635S probably damaging Het
Spg11 C T 2: 122,068,837 C1589Y probably damaging Het
Stab1 T C 14: 31,146,070 T1616A probably damaging Het
Vwde T A 6: 13,215,807 probably benign Het
Zcchc8 A G 5: 123,700,597 L626P probably benign Het
Zfhx4 A G 3: 5,397,060 H1240R probably damaging Het
Other mutations in Trappc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Trappc11 APN 8 47503302 unclassified probably benign
IGL01300:Trappc11 APN 8 47501868 missense probably benign
IGL01312:Trappc11 APN 8 47505677 missense possibly damaging 0.95
IGL01344:Trappc11 APN 8 47519704 missense probably damaging 1.00
IGL01518:Trappc11 APN 8 47501869 unclassified probably null
IGL01747:Trappc11 APN 8 47519621 missense probably benign 0.41
IGL01781:Trappc11 APN 8 47514128 missense possibly damaging 0.95
IGL01908:Trappc11 APN 8 47503994 missense probably damaging 1.00
IGL01956:Trappc11 APN 8 47528001 missense possibly damaging 0.86
IGL02266:Trappc11 APN 8 47505731 missense probably damaging 1.00
IGL02377:Trappc11 APN 8 47530650 critical splice donor site probably null
IGL02530:Trappc11 APN 8 47507582 missense probably damaging 1.00
IGL02676:Trappc11 APN 8 47493413 splice site probably benign
IGL03030:Trappc11 APN 8 47513929 missense probably damaging 0.98
IGL03393:Trappc11 APN 8 47510877 missense possibly damaging 0.95
bunyoro UTSW 8 47512285 intron probably null
nyoro UTSW 8 47526979 missense possibly damaging 0.73
serval UTSW 8 47503965 missense probably damaging 1.00
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0009:Trappc11 UTSW 8 47503320 missense possibly damaging 0.70
R0043:Trappc11 UTSW 8 47505575 splice site probably benign
R0180:Trappc11 UTSW 8 47527974 missense possibly damaging 0.86
R0529:Trappc11 UTSW 8 47526979 missense possibly damaging 0.73
R0538:Trappc11 UTSW 8 47503412 missense probably benign 0.01
R0740:Trappc11 UTSW 8 47524588 missense probably damaging 0.99
R1352:Trappc11 UTSW 8 47525046 missense possibly damaging 0.90
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1469:Trappc11 UTSW 8 47503965 missense probably damaging 1.00
R1502:Trappc11 UTSW 8 47530827 missense possibly damaging 0.94
R1589:Trappc11 UTSW 8 47501680 missense probably damaging 1.00
R1741:Trappc11 UTSW 8 47529327 critical splice donor site probably null
R2292:Trappc11 UTSW 8 47505736 missense probably damaging 1.00
R2931:Trappc11 UTSW 8 47503942 missense probably damaging 0.99
R3522:Trappc11 UTSW 8 47498673 missense possibly damaging 0.93
R3714:Trappc11 UTSW 8 47505316 intron probably benign
R3739:Trappc11 UTSW 8 47514103 missense probably damaging 0.98
R4165:Trappc11 UTSW 8 47524968 splice site probably benign
R4581:Trappc11 UTSW 8 47493345 missense probably damaging 0.97
R4598:Trappc11 UTSW 8 47513766 missense probably damaging 0.98
R4939:Trappc11 UTSW 8 47519665 missense probably damaging 1.00
R4990:Trappc11 UTSW 8 47490895 missense probably benign 0.41
R4994:Trappc11 UTSW 8 47522441 nonsense probably null
R5091:Trappc11 UTSW 8 47512604 missense probably benign 0.00
R5123:Trappc11 UTSW 8 47513402 missense probably damaging 0.99
R5176:Trappc11 UTSW 8 47510963 missense possibly damaging 0.79
R5279:Trappc11 UTSW 8 47505304 intron probably benign
R5293:Trappc11 UTSW 8 47493342 missense possibly damaging 0.83
R5294:Trappc11 UTSW 8 47530731 missense possibly damaging 0.88
R5661:Trappc11 UTSW 8 47512607 missense probably damaging 0.99
R5838:Trappc11 UTSW 8 47512559 critical splice donor site probably null
R5889:Trappc11 UTSW 8 47519578 missense probably benign 0.40
R5952:Trappc11 UTSW 8 47496917 critical splice donor site probably null
R5959:Trappc11 UTSW 8 47501558 missense probably damaging 0.97
R6239:Trappc11 UTSW 8 47529494 missense possibly damaging 0.73
R6322:Trappc11 UTSW 8 47530773 missense possibly damaging 0.95
R6369:Trappc11 UTSW 8 47512285 intron probably null
R7541:Trappc11 UTSW 8 47505582 splice site probably null
R7544:Trappc11 UTSW 8 47522414 missense possibly damaging 0.73
R7762:Trappc11 UTSW 8 47522376 missense probably damaging 0.99
R8183:Trappc11 UTSW 8 47529356 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATCAATTCCTGGGCCTTTGC -3'
(R):5'- CAGCTCAGGGTTCTATGTGG -3'

Sequencing Primer
(F):5'- GATGATATATTACTGCCAAGACCAAG -3'
(R):5'- GCTGGTGGCAGACTTTCC -3'
Posted On2014-10-30