Incidental Mutation 'R2328:Tas2r123'
ID245754
Institutional Source Beutler Lab
Gene Symbol Tas2r123
Ensembl Gene ENSMUSG00000057381
Gene Nametaste receptor, type 2, member 123
Synonymsmt2r55, Tas2r23, STC 9-2, mGR23, T2R23
MMRRC Submission 040319-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2328 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132847142-132848143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132847316 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 59 (T59S)
Ref Sequence ENSEMBL: ENSMUSP00000071615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071696]
Predicted Effect probably benign
Transcript: ENSMUST00000071696
AA Change: T59S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071615
Gene: ENSMUSG00000057381
AA Change: T59S

DomainStartEndE-ValueType
Pfam:TAS2R 7 322 4.6e-79 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 T A 4: 144,455,932 Y322F probably benign Het
Abca5 T C 11: 110,276,521 T1490A probably damaging Het
Akap1 A G 11: 88,845,044 V264A possibly damaging Het
Cggbp1 A G 16: 64,856,003 D144G probably benign Het
Cubn C A 2: 13,404,080 G1352* probably null Het
Cyfip1 T A 7: 55,894,991 M457K possibly damaging Het
Dag1 T C 9: 108,209,252 N230S probably damaging Het
Dbh T C 2: 27,165,730 V72A probably benign Het
Dnah11 A G 12: 117,886,686 S4218P probably damaging Het
Dnah8 A T 17: 30,794,744 I3820F probably damaging Het
Erbb3 C T 10: 128,583,693 C186Y probably damaging Het
Foxd1 T C 13: 98,355,152 I178T probably damaging Het
Gpc5 C T 14: 115,788,179 R470W probably damaging Het
Hace1 G T 10: 45,648,945 R269L probably benign Het
Inpp5a A T 7: 139,478,094 K73* probably null Het
Olfr976 A G 9: 39,956,900 F24L possibly damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Pzp T C 6: 128,510,390 I504V possibly damaging Het
Scgb1b19 T A 7: 33,288,486 C93S probably damaging Het
Setx TGTGG T 2: 29,154,060 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slamf6 G A 1: 171,934,251 V80I probably benign Het
Snapc3 T A 4: 83,435,277 Y184* probably null Het
Spg21 T C 9: 65,486,873 I284T possibly damaging Het
Trip11 T G 12: 101,878,827 *139C probably null Het
Trp53inp1 T C 4: 11,164,495 V13A probably benign Het
Wtap C T 17: 12,967,538 R374Q possibly damaging Het
Ydjc A G 16: 17,147,122 E47G possibly damaging Het
Zc3h6 A G 2: 128,993,202 D86G possibly damaging Het
Other mutations in Tas2r123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Tas2r123 APN 6 132847406 missense probably benign 0.01
IGL01547:Tas2r123 APN 6 132847458 missense probably damaging 1.00
IGL02576:Tas2r123 APN 6 132847740 missense possibly damaging 0.96
IGL03303:Tas2r123 APN 6 132847438 missense probably damaging 1.00
R0068:Tas2r123 UTSW 6 132847992 missense possibly damaging 0.66
R0068:Tas2r123 UTSW 6 132847992 missense possibly damaging 0.66
R0110:Tas2r123 UTSW 6 132847332 missense probably benign 0.01
R0364:Tas2r123 UTSW 6 132847681 missense probably benign
R0415:Tas2r123 UTSW 6 132847838 missense probably damaging 0.97
R0469:Tas2r123 UTSW 6 132847332 missense probably benign 0.01
R1791:Tas2r123 UTSW 6 132847565 missense probably damaging 1.00
R1976:Tas2r123 UTSW 6 132847332 missense probably damaging 0.96
R4282:Tas2r123 UTSW 6 132848045 missense possibly damaging 0.75
R4283:Tas2r123 UTSW 6 132848045 missense possibly damaging 0.75
R4939:Tas2r123 UTSW 6 132847845 missense probably benign 0.32
R5079:Tas2r123 UTSW 6 132847718 missense probably benign 0.01
R5241:Tas2r123 UTSW 6 132847218 missense probably benign 0.06
R5288:Tas2r123 UTSW 6 132847227 missense probably benign 0.17
R5851:Tas2r123 UTSW 6 132847308 missense probably damaging 1.00
R6725:Tas2r123 UTSW 6 132847838 missense probably damaging 0.97
R6895:Tas2r123 UTSW 6 132847170 missense probably benign
R7017:Tas2r123 UTSW 6 132847550 missense probably benign 0.00
R7183:Tas2r123 UTSW 6 132847698 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAACCCAAGATTTTCATGGAGG -3'
(R):5'- AAGCAGCAATTGAGAACTGATC -3'

Sequencing Primer
(F):5'- CCCAAGATTTTCATGGAGGAATTATG -3'
(R):5'- GCAATTGAGAACTGATCATATATCCC -3'
Posted On2014-10-30