Incidental Mutation 'R2389:Kdm4c'
ID247728
Institutional Source Beutler Lab
Gene Symbol Kdm4c
Ensembl Gene ENSMUSG00000028397
Gene Namelysine (K)-specific demethylase 4C
SynonymsJmjd2c, 2410141F18Rik
Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2389 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location74242497-74405860 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 74333870 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851] [ENSMUST00000149295]
Predicted Effect probably null
Transcript: ENSMUST00000030102
SMART Domains Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000077851
SMART Domains Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149295
SMART Domains Protein: ENSMUSP00000118728
Gene: ENSMUSG00000028397

DomainStartEndE-ValueType
Pfam:JmjN 17 49 9.4e-14 PFAM
low complexity region 102 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156065
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]
Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 T C 2: 158,625,212 V24A probably benign Het
Adrm1 C A 2: 180,174,323 probably benign Het
Cdk13 T A 13: 17,751,776 H813L probably damaging Het
Cdkal1 T A 13: 29,552,236 H300L probably damaging Het
Cnksr1 T C 4: 134,233,746 I235V probably benign Het
Ctnnd1 T A 2: 84,624,271 Q11L probably null Het
Dync2h1 T C 9: 7,122,618 I2113V possibly damaging Het
Eng T C 2: 32,657,672 probably null Het
Gm13119 T A 4: 144,363,413 L341H probably damaging Het
Gria2 A G 3: 80,702,625 W626R probably damaging Het
Kctd1 A G 18: 15,062,211 S452P possibly damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Nat8f7 C A 6: 85,707,494 M121I probably benign Het
Ppfibp1 A T 6: 147,022,171 H667L probably damaging Het
Prss12 A G 3: 123,487,021 N452D possibly damaging Het
Rab17 T C 1: 90,964,204 T33A probably benign Het
Rxfp3 A G 15: 11,036,684 C201R probably damaging Het
Spag17 A G 3: 100,106,837 Y2142C probably benign Het
Stx6 T C 1: 155,197,418 V225A possibly damaging Het
Ugt2b5 G A 5: 87,127,682 P437S probably damaging Het
Usp13 A G 3: 32,905,464 K568R probably benign Het
Zan A G 5: 137,476,380 probably null Het
Zbtb8b T C 4: 129,433,273 E33G probably benign Het
Zcchc17 T A 4: 130,327,204 K185* probably null Het
Other mutations in Kdm4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Kdm4c APN 4 74345501 missense probably benign 0.19
IGL00225:Kdm4c APN 4 74345567 missense probably benign 0.03
IGL00672:Kdm4c APN 4 74343514 missense probably benign 0.00
IGL00897:Kdm4c APN 4 74373684 missense probably damaging 1.00
IGL01479:Kdm4c APN 4 74343501 missense probably benign 0.18
IGL01707:Kdm4c APN 4 74336927 missense probably damaging 1.00
IGL02142:Kdm4c APN 4 74307016 critical splice donor site probably null
IGL02268:Kdm4c APN 4 74373716 missense possibly damaging 0.94
IGL02662:Kdm4c APN 4 74404821 missense probably damaging 0.99
IGL03377:Kdm4c APN 4 74271255 missense possibly damaging 0.82
3-1:Kdm4c UTSW 4 74334673 missense probably benign 0.00
BB002:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
BB012:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
PIT4434001:Kdm4c UTSW 4 74271332 missense probably benign 0.01
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0219:Kdm4c UTSW 4 74373620 missense probably damaging 1.00
R0309:Kdm4c UTSW 4 74345567 missense probably benign 0.00
R0512:Kdm4c UTSW 4 74333794 missense probably benign
R1070:Kdm4c UTSW 4 74373628 nonsense probably null
R1518:Kdm4c UTSW 4 74333826 missense probably benign
R1713:Kdm4c UTSW 4 74298484 missense probably benign 0.10
R1769:Kdm4c UTSW 4 74280997 missense possibly damaging 0.66
R1927:Kdm4c UTSW 4 74345483 missense probably benign 0.00
R1962:Kdm4c UTSW 4 74307016 intron probably benign
R1992:Kdm4c UTSW 4 74343394 missense possibly damaging 0.71
R2979:Kdm4c UTSW 4 74373728 nonsense probably null
R3966:Kdm4c UTSW 4 74298583 missense probably damaging 1.00
R4094:Kdm4c UTSW 4 74311678 missense probably benign
R4171:Kdm4c UTSW 4 74280898 missense possibly damaging 0.73
R4543:Kdm4c UTSW 4 74330760 missense probably benign 0.01
R4581:Kdm4c UTSW 4 74357339 splice site probably null
R5019:Kdm4c UTSW 4 74343535 missense probably damaging 1.00
R5088:Kdm4c UTSW 4 74334699 missense probably benign
R5533:Kdm4c UTSW 4 74315649 intron probably benign
R5663:Kdm4c UTSW 4 74399348 missense probably damaging 1.00
R5691:Kdm4c UTSW 4 74334728 missense probably benign
R5775:Kdm4c UTSW 4 74359431 missense probably damaging 1.00
R5786:Kdm4c UTSW 4 74359485 missense probably damaging 0.98
R6002:Kdm4c UTSW 4 74404969 missense possibly damaging 0.95
R6375:Kdm4c UTSW 4 74330715 missense probably damaging 0.96
R6491:Kdm4c UTSW 4 74373636 missense probably damaging 1.00
R6790:Kdm4c UTSW 4 74391461 missense probably damaging 1.00
R6952:Kdm4c UTSW 4 74357350 missense probably damaging 1.00
R7157:Kdm4c UTSW 4 74345567 missense probably benign 0.01
R7319:Kdm4c UTSW 4 74336963 missense probably damaging 1.00
R7925:Kdm4c UTSW 4 74404821 missense probably damaging 0.99
R7976:Kdm4c UTSW 4 74377669 missense probably damaging 0.99
R7990:Kdm4c UTSW 4 74391448 missense probably damaging 1.00
R8185:Kdm4c UTSW 4 74373584 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGAAGAAGATGAGGAATTTGCTG -3'
(R):5'- AGTCTGAAACAAGGTATCTGAACAG -3'

Sequencing Primer
(F):5'- AATTTGCTGAATTTAGTGGGGAAGAG -3'
(R):5'- GCTGAATTTCACTAAAACTTTCTGC -3'
Posted On2014-11-11