Incidental Mutation 'R2412:Acad9'
ID250024
Institutional Source Beutler Lab
Gene Symbol Acad9
Ensembl Gene ENSMUSG00000027710
Gene Nameacyl-Coenzyme A dehydrogenase family, member 9
Synonyms2600017P15Rik, NPD002, C630012L17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R2412 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location36065979-36092853 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36073591 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 114 (Q114L)
Ref Sequence ENSEMBL: ENSMUSP00000142557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011492] [ENSMUST00000196648] [ENSMUST00000197588]
Predicted Effect probably benign
Transcript: ENSMUST00000011492
AA Change: Q114L

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000011492
Gene: ENSMUSG00000027710
AA Change: Q114L

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 177 1.2e-25 PFAM
Pfam:Acyl-CoA_dh_M 181 282 2e-27 PFAM
Pfam:Acyl-CoA_dh_1 294 445 9.6e-42 PFAM
Pfam:Acyl-CoA_dh_2 309 434 3.6e-12 PFAM
Blast:HisKA 448 550 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196535
Predicted Effect probably benign
Transcript: ENSMUST00000196648
AA Change: Q114L

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142557
Gene: ENSMUSG00000027710
AA Change: Q114L

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 69 156 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197344
Predicted Effect probably benign
Transcript: ENSMUST00000197588
SMART Domains Protein: ENSMUSP00000142995
Gene: ENSMUSG00000027710

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_1 16 155 1.9e-37 PFAM
Pfam:Acyl-CoA_dh_2 31 156 8.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198987
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 A G 5: 89,701,771 Y597H probably damaging Het
Bmi1 A G 2: 18,683,714 H172R probably damaging Het
Cyp3a44 A T 5: 145,779,579 Y400* probably null Het
Dennd5b T C 6: 149,005,238 T1062A possibly damaging Het
Dync2h1 T C 9: 7,144,246 D1065G probably benign Het
Ephb1 G A 9: 102,001,816 R492C possibly damaging Het
Fat4 A T 3: 38,957,072 H2107L probably benign Het
Gm10436 A G 12: 88,177,110 V311A probably damaging Het
Itga8 A G 2: 12,301,715 V23A probably benign Het
Lrba A G 3: 86,327,700 N851D probably damaging Het
Ltbp3 A G 19: 5,746,645 T322A probably benign Het
Ntpcr T C 8: 125,745,405 V151A probably damaging Het
Olfr1012 C A 2: 85,759,680 G232V probably damaging Het
Olfr1097 T C 2: 86,890,834 I114V probably benign Het
Rps6ka4 A T 19: 6,829,941 *774K probably null Het
Slc12a5 T C 2: 164,976,462 probably null Het
Tmem219 T C 7: 126,896,767 S37G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Tubb1 A G 2: 174,457,110 N195S possibly damaging Het
Zan A G 5: 137,414,163 probably null Het
Zfp85 T C 13: 67,749,646 I102M probably damaging Het
Other mutations in Acad9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Acad9 APN 3 36069762 missense probably benign 0.06
IGL01161:Acad9 APN 3 36090125 missense possibly damaging 0.93
IGL02016:Acad9 APN 3 36088486 critical splice acceptor site probably null
IGL02100:Acad9 APN 3 36081880 missense probably null 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0098:Acad9 UTSW 3 36073540 missense probably damaging 1.00
R0119:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R0499:Acad9 UTSW 3 36085415 missense probably damaging 0.99
R1444:Acad9 UTSW 3 36078508 missense possibly damaging 0.80
R1564:Acad9 UTSW 3 36089429 missense possibly damaging 0.53
R2013:Acad9 UTSW 3 36073588 missense probably damaging 0.97
R2113:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R2428:Acad9 UTSW 3 36090923 missense probably benign
R4214:Acad9 UTSW 3 36073603 missense probably damaging 0.99
R4291:Acad9 UTSW 3 36066188 missense probably benign 0.14
R4562:Acad9 UTSW 3 36066182 missense probably benign 0.31
R4679:Acad9 UTSW 3 36088840 missense possibly damaging 0.79
R4758:Acad9 UTSW 3 36073605 missense probably damaging 1.00
R4953:Acad9 UTSW 3 36074376 missense probably damaging 1.00
R4970:Acad9 UTSW 3 36085525 missense probably damaging 1.00
R5137:Acad9 UTSW 3 36069771 missense probably benign 0.28
R5171:Acad9 UTSW 3 36074398 missense possibly damaging 0.94
R5956:Acad9 UTSW 3 36075174 unclassified probably benign
R6285:Acad9 UTSW 3 36082175 missense probably benign 0.01
R6620:Acad9 UTSW 3 36066145 missense possibly damaging 0.93
R6880:Acad9 UTSW 3 36069705 splice site probably null
R6995:Acad9 UTSW 3 36085481 missense probably damaging 1.00
R7286:Acad9 UTSW 3 36075990 missense probably damaging 1.00
R7501:Acad9 UTSW 3 36088825 missense probably benign
R7705:Acad9 UTSW 3 36088526 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTAGGCTATACAAAACCCTTCTG -3'
(R):5'- ACCATCTGCTGTAGAAGGGAG -3'

Sequencing Primer
(F):5'- GGCTATACAAAACCCTTCTGTATAC -3'
(R):5'- AAGGGAGGCTATACTTCAGTATCTG -3'
Posted On2014-11-12