Incidental Mutation 'R2511:Ugt1a2'
ID252831
Institutional Source Beutler Lab
Gene Symbol Ugt1a2
Ensembl Gene ENSMUSG00000090171
Gene NameUDP glucuronosyltransferase 1 family, polypeptide A2
Synonyms
MMRRC Submission 040417-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R2511 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location88200601-88218997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88201124 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 163 (Y163C)
Ref Sequence ENSEMBL: ENSMUSP00000037258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000119972] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000049289
AA Change: Y163C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171
AA Change: Y163C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119972
SMART Domains Protein: ENSMUSP00000112703
Gene: ENSMUSG00000081984

DomainStartEndE-ValueType
DnaJ 2 61 6.22e-33 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. Substrates of this enzyme include estrone, 2-hydroxyestrone, and metabolites of benzo alpha-pyrene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,625,300 M506V probably benign Het
9330159F19Rik T A 10: 29,221,906 C100S probably damaging Het
Abcc8 C T 7: 46,150,780 R526H probably damaging Het
Acad10 G A 5: 121,631,567 P609S probably benign Het
Acod1 A T 14: 103,051,339 D95V probably damaging Het
Acsm5 A T 7: 119,530,454 I130F possibly damaging Het
Ago4 A T 4: 126,517,071 D208E probably damaging Het
Agrn A T 4: 156,166,424 probably null Het
Ankar A T 1: 72,658,694 I791K probably damaging Het
Ano10 A G 9: 122,258,945 V364A probably damaging Het
Arhgap9 T C 10: 127,328,985 probably null Het
Arsi G A 18: 60,916,594 C183Y probably damaging Het
Ascl2 T G 7: 142,968,216 E97A probably damaging Het
Asna1 A G 8: 85,019,766 V151A possibly damaging Het
Bcl2a1a C T 9: 88,957,453 R135W probably damaging Het
Bms1 C T 6: 118,391,153 probably null Het
Bysl T A 17: 47,604,335 T163S probably benign Het
Card10 A G 15: 78,780,273 I821T probably benign Het
Cc2d2a A T 5: 43,735,395 Q1433L probably damaging Het
Cchcr1 T C 17: 35,530,513 S809P probably benign Het
Ccz1 G T 5: 144,012,997 T70K probably damaging Het
Cdc25c G C 18: 34,738,239 L275V probably damaging Het
Cep164 A T 9: 45,775,249 L729Q probably damaging Het
Clcn6 A G 4: 148,017,494 probably null Het
Clcn7 T A 17: 25,155,446 V507E probably damaging Het
Ctso A C 3: 81,932,734 T24P probably damaging Het
Dis3l2 A T 1: 86,990,258 N543I probably benign Het
Dnah12 A T 14: 26,769,950 Y1114F possibly damaging Het
Emx1 A G 6: 85,204,051 D250G probably benign Het
Epha4 G A 1: 77,511,702 A47V possibly damaging Het
Fam149b A C 14: 20,378,456 N341T probably damaging Het
Fsip2 A G 2: 82,951,657 K62R probably damaging Het
Fsip2 T C 2: 82,986,438 S4172P probably benign Het
Gbp3 A G 3: 142,570,582 R480G probably benign Het
Gja8 T G 3: 96,919,717 T210P probably damaging Het
Gm13103 G A 4: 143,851,991 V274I probably benign Het
Gm5431 T A 11: 48,888,709 N740I probably benign Het
Gm9930 T C 10: 9,534,702 noncoding transcript Het
Gstt4 C T 10: 75,815,125 C221Y probably benign Het
Gzmg A T 14: 56,158,375 D42E probably benign Het
Hoxd12 G A 2: 74,675,471 A129T possibly damaging Het
Hs2st1 G A 3: 144,569,930 probably benign Het
Ifnlr1 G T 4: 135,705,248 D332Y probably damaging Het
Igsf10 T C 3: 59,331,866 D298G probably damaging Het
Irf1 T C 11: 53,773,791 V108A probably damaging Het
Jsrp1 C G 10: 80,812,306 S36T probably benign Het
Kcnq5 T A 1: 21,505,782 R233* probably null Het
Kif7 T C 7: 79,702,264 K917E probably damaging Het
Krt7 A C 15: 101,412,657 I62L probably benign Het
Lifr A G 15: 7,166,916 T194A probably benign Het
Ltbp2 T C 12: 84,804,409 probably null Het
Man2c1 A G 9: 57,141,388 probably null Het
Met T C 6: 17,491,967 S243P probably damaging Het
Mllt10 C A 2: 18,065,124 D30E possibly damaging Het
Mre11a A C 9: 14,795,769 probably null Het
Mroh9 A G 1: 163,038,945 S710P probably benign Het
Mvk C A 5: 114,450,398 Y116* probably null Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncf1 T C 5: 134,225,698 D184G probably damaging Het
Nxpe4 T C 9: 48,393,233 F207L probably damaging Het
Olfr10 T G 11: 49,318,221 L225R probably damaging Het
Olfr1137 T C 2: 87,711,048 N286S probably damaging Het
Olfr1301 T A 2: 111,754,316 N22K probably benign Het
Olfr1449 T A 19: 12,935,173 M145K possibly damaging Het
Olfr690 A T 7: 105,329,610 I194N probably damaging Het
Olfr700 G T 7: 106,805,961 P167H probably damaging Het
Pcdh1 G A 18: 38,199,479 T296M possibly damaging Het
Pcdh15 A G 10: 74,645,996 D391G possibly damaging Het
Pcdha7 C A 18: 36,974,733 D270E probably damaging Het
Pgam1 C A 19: 41,915,876 S137R probably damaging Het
Pitpnm2 T C 5: 124,136,326 E240G probably damaging Het
Plce1 T G 19: 38,760,054 I1729S probably damaging Het
Plppr4 G T 3: 117,331,706 N161K probably damaging Het
Prkce T A 17: 86,625,326 I578N probably damaging Het
Prss58 A C 6: 40,897,800 S36A probably damaging Het
Ptprm T C 17: 66,693,778 H1128R probably damaging Het
Rgs9 T C 11: 109,268,972 Y178C probably benign Het
Rubcn T C 16: 32,847,254 N179S probably damaging Het
Sh3bp1 C T 15: 78,911,506 P612S probably damaging Het
Sh3bp5 G A 14: 31,411,629 T82M probably damaging Het
Shank2 A G 7: 144,411,577 Y974C probably damaging Het
Slc9c1 T C 16: 45,544,736 I144T possibly damaging Het
Slf2 T C 19: 44,941,606 I374T possibly damaging Het
Snx13 A G 12: 35,138,081 D786G probably benign Het
Spcs3 A G 8: 54,523,354 V151A possibly damaging Het
Sstr2 A T 11: 113,624,923 I223F probably damaging Het
Stac3 T C 10: 127,503,918 probably null Het
Tas1r2 A G 4: 139,659,851 N207S probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgm5 T C 2: 121,076,948 E98G possibly damaging Het
Tktl2 A G 8: 66,512,852 E354G probably benign Het
Tmem57 A G 4: 134,804,388 S657P probably damaging Het
Tmem94 G A 11: 115,791,961 R608H probably damaging Het
Tnrc6a G A 7: 123,171,092 V702I probably damaging Het
Trappc10 A G 10: 78,211,523 S380P possibly damaging Het
Trim24 G A 6: 37,903,652 probably null Het
Vmn1r215 A G 13: 23,076,173 I128V probably benign Het
Vmn2r50 T A 7: 10,047,713 E368D possibly damaging Het
Vmn2r59 T C 7: 42,043,766 N470S probably damaging Het
Vps45 T C 3: 96,041,445 T333A probably benign Het
Zbtb44 T A 9: 31,054,243 D316E probably damaging Het
Zdhhc1 C T 8: 105,483,558 V76M probably benign Het
Zfp235 T C 7: 24,142,124 F656S probably damaging Het
Other mutations in Ugt1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Ugt1a2 APN 1 88201074 missense probably damaging 1.00
R0680:Ugt1a2 UTSW 1 88201211 missense probably damaging 1.00
R1770:Ugt1a2 UTSW 1 88201438 missense probably benign 0.01
R2122:Ugt1a2 UTSW 1 88201013 missense possibly damaging 0.89
R4890:Ugt1a2 UTSW 1 88200812 missense probably damaging 0.99
R5485:Ugt1a2 UTSW 1 88201246 missense probably damaging 0.96
R5603:Ugt1a2 UTSW 1 88201426 missense probably damaging 1.00
R5827:Ugt1a2 UTSW 1 88201065 missense probably damaging 0.99
R7070:Ugt1a2 UTSW 1 88201502 critical splice donor site probably null
R7120:Ugt1a2 UTSW 1 88200800 missense probably damaging 1.00
R7644:Ugt1a2 UTSW 1 88200785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGAGCGACATTGAGAAGACC -3'
(R):5'- AACGGCAAATGTACTTCAGGACC -3'

Sequencing Primer
(F):5'- GCGACATTGAGAAGACCTTTAAAAC -3'
(R):5'- CCAGATAGTACAGCATGTTCTGG -3'
Posted On2014-12-04