Incidental Mutation 'R2842:Gprc5b'
ID254325
Institutional Source Beutler Lab
Gene Symbol Gprc5b
Ensembl Gene ENSMUSG00000008734
Gene NameG protein-coupled receptor, family C, group 5, member B
Synonymshypothetical protein, clone 2-63
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R2842 (G1)
Quality Score223
Status Not validated
Chromosome7
Chromosomal Location118972047-118995211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118984079 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 189 (T189M)
Ref Sequence ENSEMBL: ENSMUSP00000146777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008878] [ENSMUST00000208394]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008878
AA Change: T189M

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000008878
Gene: ENSMUSG00000008734
AA Change: T189M

DomainStartEndE-ValueType
Pfam:7tm_3 67 294 2e-33 PFAM
low complexity region 360 371 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208394
AA Change: T189M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The encoded protein may modulate insulin secretion and increased protein expression is associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit partial neonatal and postnatal lethality, altered spontaneous activity pattern, and decreased response to a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Arl8a T C 1: 135,155,251 S181P probably damaging Het
Armc8 A G 9: 99,505,681 S396P probably benign Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a C T 12: 51,955,477 probably null Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Lce1e T A 3: 92,707,749 H97L unknown Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Otud7b G A 3: 96,136,594 E19K probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Prkag3 T C 1: 74,741,175 I444V probably benign Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tmem225 T C 9: 40,149,801 Y135H probably damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Gprc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Gprc5b APN 7 118983861 missense probably benign
IGL01687:Gprc5b APN 7 118983986 missense possibly damaging 0.67
IGL02937:Gprc5b APN 7 118983794 missense probably benign 0.36
IGL03088:Gprc5b APN 7 118983633 missense probably benign 0.08
IGL03106:Gprc5b APN 7 118984193 missense probably damaging 1.00
IGL03166:Gprc5b APN 7 118983999 missense probably benign 0.20
R0189:Gprc5b UTSW 7 118983633 missense probably benign 0.08
R0588:Gprc5b UTSW 7 118983995 missense probably benign
R1563:Gprc5b UTSW 7 118983761 missense probably benign 0.22
R2126:Gprc5b UTSW 7 118984175 missense probably damaging 1.00
R3153:Gprc5b UTSW 7 118976547 missense probably damaging 1.00
R3802:Gprc5b UTSW 7 118983720 missense possibly damaging 0.92
R3978:Gprc5b UTSW 7 118984131 missense probably damaging 1.00
R4007:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4183:Gprc5b UTSW 7 118984526 missense probably benign 0.03
R4297:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4298:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R4299:Gprc5b UTSW 7 118984214 missense possibly damaging 0.55
R5286:Gprc5b UTSW 7 118983687 missense possibly damaging 0.93
R6492:Gprc5b UTSW 7 118984577 missense possibly damaging 0.68
R6606:Gprc5b UTSW 7 118984073 missense probably benign 0.00
R7085:Gprc5b UTSW 7 118983632 missense probably damaging 0.97
R7312:Gprc5b UTSW 7 118984259 missense probably damaging 1.00
R7593:Gprc5b UTSW 7 118984269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGAGGTACATGGTCATCC -3'
(R):5'- ACAATCTGCTCCATCCGACG -3'

Sequencing Primer
(F):5'- GTCATCCAGACCACCCAGATGAG -3'
(R):5'- ATCCGACGCTTCCTCTGGG -3'
Posted On2014-12-04