Incidental Mutation 'R2842:Tmem225'
ID254339
Institutional Source Beutler Lab
Gene Symbol Tmem225
Ensembl Gene ENSMUSG00000040541
Gene Nametransmembrane protein 225
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2842 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40148122-40150880 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40149801 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 135 (Y135H)
Ref Sequence ENSEMBL: ENSMUSP00000036816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046333]
Predicted Effect probably damaging
Transcript: ENSMUST00000046333
AA Change: Y135H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000036816
Gene: ENSMUSG00000040541
AA Change: Y135H

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aplp2 C T 9: 31,157,826 R569Q probably benign Het
Arl8a T C 1: 135,155,251 S181P probably damaging Het
Armc8 A G 9: 99,505,681 S396P probably benign Het
Baz2b A G 2: 59,913,004 V1541A probably benign Het
Crebbp G A 16: 4,109,198 R628C probably damaging Het
Ep400 T A 5: 110,698,815 K295* probably null Het
Frem3 T A 8: 80,669,349 probably null Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gprc5b G A 7: 118,984,079 T189M possibly damaging Het
Gucy2g C T 19: 55,240,947 C97Y probably damaging Het
Heatr5a C T 12: 51,955,477 probably null Het
Heatr5a T A 12: 51,955,478 K225M probably null Het
Insr A G 8: 3,202,986 I391T probably damaging Het
Lce1e T A 3: 92,707,749 H97L unknown Het
Macf1 A G 4: 123,376,417 V6647A probably damaging Het
Mast1 T C 8: 84,923,908 R399G probably damaging Het
Mast4 C A 13: 102,736,431 S1951I probably benign Het
Mdc1 C T 17: 35,848,794 P648S probably benign Het
Mgam T C 6: 40,661,345 F410L probably benign Het
Nr2e1 T C 10: 42,568,445 R223G probably damaging Het
Otud7b G A 3: 96,136,594 E19K probably damaging Het
Plce1 T C 19: 38,524,283 S9P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Plxna4 A G 6: 32,215,631 probably null Het
Prkag3 T C 1: 74,741,175 I444V probably benign Het
Rsph10b T G 5: 143,979,892 V310G possibly damaging Het
Tox2 G A 2: 163,204,630 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Wfikkn2 G A 11: 94,238,259 T352I probably benign Het
Other mutations in Tmem225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Tmem225 APN 9 40148429 missense probably damaging 0.98
IGL03094:Tmem225 APN 9 40148386 missense possibly damaging 0.46
R0599:Tmem225 UTSW 9 40149747 missense possibly damaging 0.46
R1134:Tmem225 UTSW 9 40149847 missense possibly damaging 0.92
R4556:Tmem225 UTSW 9 40149466 missense probably damaging 0.96
R5024:Tmem225 UTSW 9 40149343 missense probably benign 0.01
R5526:Tmem225 UTSW 9 40150706 missense possibly damaging 0.92
R5540:Tmem225 UTSW 9 40149385 missense probably damaging 0.99
R5597:Tmem225 UTSW 9 40149430 missense possibly damaging 0.94
R6267:Tmem225 UTSW 9 40148435 missense probably damaging 0.97
R6314:Tmem225 UTSW 9 40150720 missense probably benign
R7153:Tmem225 UTSW 9 40148368 missense probably benign 0.01
R8031:Tmem225 UTSW 9 40149393 missense possibly damaging 0.46
R8245:Tmem225 UTSW 9 40150659 missense probably damaging 0.99
X0064:Tmem225 UTSW 9 40149786 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCTGTGCTGGACAAGATAGG -3'
(R):5'- AGCTCAGATTTCTGCTCCTAAG -3'

Sequencing Primer
(F):5'- GATGAATGGGAGTGAAACCTTACC -3'
(R):5'- GAGAGTTAGTCCAGGTCACTTTTCAC -3'
Posted On2014-12-04