Incidental Mutation 'R2980:Ddx4'
ID 257061
Institutional Source Beutler Lab
Gene Symbol Ddx4
Ensembl Gene ENSMUSG00000021758
Gene Name DEAD box helicase 4
Synonyms VASA, mvh / m'vasa, DEAD (Asp-Glu-Ala-Asp) box polypeptide 4, Mvh
Accession Numbers
Essential gene? Possibly essential (E-score: 0.686) question?
Stock # R2980 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 112734867-112789009 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 112748619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 452 (D452E)
Ref Sequence ENSEMBL: ENSMUSP00000096769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075748] [ENSMUST00000099166]
AlphaFold Q61496
Predicted Effect probably damaging
Transcript: ENSMUST00000075748
AA Change: D426E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075157
Gene: ENSMUSG00000021758
AA Change: D426E

DomainStartEndE-ValueType
Blast:DEXDc 22 165 8e-14 BLAST
low complexity region 175 183 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
DEXDc 280 491 9.38e-59 SMART
HELICc 527 608 1.18e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099166
AA Change: D452E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096769
Gene: ENSMUSG00000021758
AA Change: D452E

DomainStartEndE-ValueType
Blast:DEXDc 41 191 7e-25 BLAST
low complexity region 201 209 N/A INTRINSIC
low complexity region 247 255 N/A INTRINSIC
DEXDc 306 517 9.38e-59 SMART
HELICc 553 634 1.18e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a homolog of VASA proteins in Drosophila and several other species. The gene is specifically expressed in the germ cell lineage in both sexes and functions in germ cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Spermatogenesis is blocked in homozygous mutant mice, resulting in male infertility. Female mutant mice are fertile and do not exhibit any obvious reproductive defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(3) Gene trapped(2)

Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,633,034 (GRCm39) I236T probably benign Het
Alms1 T C 6: 85,605,817 (GRCm39) L2489P probably damaging Het
Astn1 G T 1: 158,400,521 (GRCm39) probably null Het
BC051665 T C 13: 60,932,209 (GRCm39) T127A probably damaging Het
Blnk T C 19: 40,950,794 (GRCm39) Y119C probably damaging Het
Cd200r3 T A 16: 44,774,552 (GRCm39) D188E probably benign Het
Ctdnep1 C A 11: 69,879,497 (GRCm39) A7D probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Jak1 T C 4: 101,036,978 (GRCm39) I221V probably damaging Het
Kremen1 G GGGT 11: 5,151,794 (GRCm39) probably benign Het
Sox21 T C 14: 118,472,962 (GRCm39) E29G probably damaging Het
Tox4 T C 14: 52,529,983 (GRCm39) S548P probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Zfy1 T C Y: 739,054 (GRCm39) N51D unknown Het
Other mutations in Ddx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02030:Ddx4 APN 13 112,761,311 (GRCm39) splice site probably benign
IGL02682:Ddx4 APN 13 112,758,720 (GRCm39) missense probably benign 0.04
IGL02729:Ddx4 APN 13 112,787,946 (GRCm39) utr 5 prime probably benign
H8930:Ddx4 UTSW 13 112,750,367 (GRCm39) splice site probably null
R0518:Ddx4 UTSW 13 112,761,313 (GRCm39) critical splice donor site probably null
R0521:Ddx4 UTSW 13 112,761,313 (GRCm39) critical splice donor site probably null
R1527:Ddx4 UTSW 13 112,758,773 (GRCm39) missense possibly damaging 0.95
R1548:Ddx4 UTSW 13 112,736,531 (GRCm39) missense probably damaging 1.00
R1773:Ddx4 UTSW 13 112,736,436 (GRCm39) missense probably benign
R1886:Ddx4 UTSW 13 112,759,199 (GRCm39) missense probably damaging 1.00
R1969:Ddx4 UTSW 13 112,757,276 (GRCm39) missense probably damaging 0.99
R1969:Ddx4 UTSW 13 112,736,547 (GRCm39) missense probably damaging 0.99
R1970:Ddx4 UTSW 13 112,736,547 (GRCm39) missense probably damaging 0.99
R1971:Ddx4 UTSW 13 112,736,547 (GRCm39) missense probably damaging 0.99
R2265:Ddx4 UTSW 13 112,757,810 (GRCm39) missense probably benign 0.08
R2280:Ddx4 UTSW 13 112,757,190 (GRCm39) missense probably benign 0.03
R2846:Ddx4 UTSW 13 112,741,146 (GRCm39) missense probably damaging 0.99
R2906:Ddx4 UTSW 13 112,757,311 (GRCm39) splice site probably benign
R3732:Ddx4 UTSW 13 112,748,516 (GRCm39) missense possibly damaging 0.56
R4085:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4088:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4089:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4090:Ddx4 UTSW 13 112,750,295 (GRCm39) missense probably benign 0.05
R4600:Ddx4 UTSW 13 112,748,594 (GRCm39) missense probably damaging 1.00
R4610:Ddx4 UTSW 13 112,748,594 (GRCm39) missense probably damaging 1.00
R4669:Ddx4 UTSW 13 112,758,778 (GRCm39) missense probably damaging 1.00
R4700:Ddx4 UTSW 13 112,750,269 (GRCm39) missense probably damaging 1.00
R4782:Ddx4 UTSW 13 112,787,894 (GRCm39) missense probably benign 0.10
R4782:Ddx4 UTSW 13 112,750,230 (GRCm39) critical splice donor site probably null
R5326:Ddx4 UTSW 13 112,757,779 (GRCm39) missense probably damaging 1.00
R5542:Ddx4 UTSW 13 112,757,779 (GRCm39) missense probably damaging 1.00
R6111:Ddx4 UTSW 13 112,757,766 (GRCm39) nonsense probably null
R6253:Ddx4 UTSW 13 112,772,557 (GRCm39) missense probably benign 0.00
R6253:Ddx4 UTSW 13 112,772,556 (GRCm39) nonsense probably null
R6286:Ddx4 UTSW 13 112,750,269 (GRCm39) missense probably damaging 1.00
R6518:Ddx4 UTSW 13 112,741,081 (GRCm39) missense probably benign
R6645:Ddx4 UTSW 13 112,777,708 (GRCm39) missense possibly damaging 0.70
R7017:Ddx4 UTSW 13 112,738,022 (GRCm39) missense probably damaging 1.00
R7155:Ddx4 UTSW 13 112,750,319 (GRCm39) missense probably benign 0.01
R7822:Ddx4 UTSW 13 112,748,647 (GRCm39) missense probably damaging 1.00
R7921:Ddx4 UTSW 13 112,738,041 (GRCm39) missense probably benign
R8041:Ddx4 UTSW 13 112,762,928 (GRCm39) missense probably benign
R8048:Ddx4 UTSW 13 112,758,706 (GRCm39) missense probably null 1.00
R8939:Ddx4 UTSW 13 112,758,823 (GRCm39) missense probably benign 0.21
R9325:Ddx4 UTSW 13 112,736,441 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGGTTGTGCATAGGGAGGC -3'
(R):5'- GAGGTGTTCTTCCCAGCTGA -3'

Sequencing Primer
(F):5'- ACTGAAATCTGGGATCTGCC -3'
(R):5'- CCCAGCTGATTCTAGTTGTGTCAAG -3'
Posted On 2015-01-11