Incidental Mutation 'R2983:Olfr180'
ID257132
Institutional Source Beutler Lab
Gene Symbol Olfr180
Ensembl Gene ENSMUSG00000090629
Gene Nameolfactory receptor 180
SynonymsMOR184-11P, GA_x54KRFPKG5P-55134972-55134019, Olfr1563-ps1, MOR184-9, MOR184-11P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R2983 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58914285-58929392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58916567 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 25 (T25S)
Ref Sequence ENSEMBL: ENSMUSP00000145601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171656] [ENSMUST00000205883] [ENSMUST00000206168]
Predicted Effect probably benign
Transcript: ENSMUST00000171656
AA Change: T25S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128358
Gene: ENSMUSG00000090629
AA Change: T25S

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-51 PFAM
Pfam:7tm_1 41 313 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205883
AA Change: T25S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
AA Change: T25S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,623,214 D347G probably damaging Het
Brwd1 T C 16: 96,066,574 K124E probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dlec1 T C 9: 119,146,173 V1607A probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Flnb T A 14: 7,882,250 V317E probably damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15448 A T 7: 3,821,575 S503T probably damaging Het
Kmt2c AGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 5: 25,315,757 probably benign Het
Ncs1 C T 2: 31,284,696 T144I probably damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Prkcd G A 14: 30,599,478 S552L probably damaging Het
Rad54l2 A G 9: 106,700,590 V1044A probably benign Het
Rasal1 A G 5: 120,654,862 H60R probably benign Het
Rccd1 G A 7: 80,320,528 Q114* probably null Het
Speg T C 1: 75,384,930 V90A possibly damaging Het
St8sia1 A G 6: 142,963,629 V47A probably damaging Het
Tex264 A G 9: 106,682,097 I10T unknown Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn1r81 G A 7: 12,260,669 T4I probably benign Het
Other mutations in Olfr180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr180 APN 16 58915850 missense probably benign 0.01
IGL01759:Olfr180 APN 16 58915928 missense probably damaging 0.99
IGL02499:Olfr180 APN 16 58916251 missense probably damaging 1.00
IGL02890:Olfr180 APN 16 58916374 missense probably benign 0.03
R1123:Olfr180 UTSW 16 58916334 nonsense probably null
R1292:Olfr180 UTSW 16 58915771 missense probably damaging 1.00
R3894:Olfr180 UTSW 16 58916339 missense probably benign 0.28
R4176:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R4666:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R5058:Olfr180 UTSW 16 58916072 missense probably benign 0.00
R5375:Olfr180 UTSW 16 58915885 missense possibly damaging 0.83
R5998:Olfr180 UTSW 16 58916630 missense probably benign
R6225:Olfr180 UTSW 16 58916182 missense probably benign 0.32
R6315:Olfr180 UTSW 16 58916246 missense probably damaging 1.00
R6380:Olfr180 UTSW 16 58916264 missense probably damaging 1.00
R6866:Olfr180 UTSW 16 58915988 missense probably damaging 1.00
R7513:Olfr180 UTSW 16 58915932 missense probably damaging 1.00
R7582:Olfr180 UTSW 16 58916047 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTGTGCCATGCATTCATAGAG -3'
(R):5'- AGAACCTCACCTGTGCATTG -3'

Sequencing Primer
(F):5'- AAGAAGTTCTCTAGCATCTTGGGAG -3'
(R):5'- CCTCACCTGTGCATTGTAAATAGAG -3'
Posted On2015-01-11