Incidental Mutation 'R4176:Olfr180'
ID319527
Institutional Source Beutler Lab
Gene Symbol Olfr180
Ensembl Gene ENSMUSG00000090629
Gene Nameolfactory receptor 180
SynonymsMOR184-11P, GA_x54KRFPKG5P-55134972-55134019, Olfr1563-ps1, MOR184-9, MOR184-11P
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58914285-58929392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58916584 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 19 (D19G)
Ref Sequence ENSEMBL: ENSMUSP00000145802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171656] [ENSMUST00000205883] [ENSMUST00000206168]
Predicted Effect probably benign
Transcript: ENSMUST00000171656
AA Change: D19G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128358
Gene: ENSMUSG00000090629
AA Change: D19G

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.4e-51 PFAM
Pfam:7tm_1 41 313 1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205883
AA Change: D19G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
AA Change: D19G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Olfr180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr180 APN 16 58915850 missense probably benign 0.01
IGL01759:Olfr180 APN 16 58915928 missense probably damaging 0.99
IGL02499:Olfr180 APN 16 58916251 missense probably damaging 1.00
IGL02890:Olfr180 APN 16 58916374 missense probably benign 0.03
R1123:Olfr180 UTSW 16 58916334 nonsense probably null
R1292:Olfr180 UTSW 16 58915771 missense probably damaging 1.00
R2983:Olfr180 UTSW 16 58916567 missense probably benign 0.00
R3894:Olfr180 UTSW 16 58916339 missense probably benign 0.28
R4666:Olfr180 UTSW 16 58916584 missense probably benign 0.01
R5058:Olfr180 UTSW 16 58916072 missense probably benign 0.00
R5375:Olfr180 UTSW 16 58915885 missense possibly damaging 0.83
R5998:Olfr180 UTSW 16 58916630 missense probably benign
R6225:Olfr180 UTSW 16 58916182 missense probably benign 0.32
R6315:Olfr180 UTSW 16 58916246 missense probably damaging 1.00
R6380:Olfr180 UTSW 16 58916264 missense probably damaging 1.00
R6866:Olfr180 UTSW 16 58915988 missense probably damaging 1.00
R7513:Olfr180 UTSW 16 58915932 missense probably damaging 1.00
R7582:Olfr180 UTSW 16 58916047 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CATCTTGGGAGTGATGGCAC -3'
(R):5'- ACCTGAGCGTGGTTTCTTC -3'

Sequencing Primer
(F):5'- CAGGAGCAGCAGGAGTCCATC -3'
(R):5'- CATGACATATTTCAAGGGACAGC -3'
Posted On2015-06-10