Incidental Mutation 'R3000:Ripor3'
ID257242
Institutional Source Beutler Lab
Gene Symbol Ripor3
Ensembl Gene ENSMUSG00000074577
Gene NameRIPOR family member 3
Synonyms2310033K02Rik, Fam65c
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3000 (G1)
Quality Score173
Status Not validated
Chromosome2
Chromosomal Location167980164-168010618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167991180 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 357 (Y357N)
Ref Sequence ENSEMBL: ENSMUSP00000096672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099073]
Predicted Effect probably damaging
Transcript: ENSMUST00000099073
AA Change: Y357N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096672
Gene: ENSMUSG00000074577
AA Change: Y357N

DomainStartEndE-ValueType
Pfam:PL48 19 363 3.5e-169 PFAM
low complexity region 414 423 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
SCOP:d1gw5a_ 794 909 6e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142702
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 A G 8: 23,119,431 K1364E probably damaging Het
Ankrd27 T A 7: 35,608,330 N331K probably damaging Het
Bco2 C A 9: 50,538,929 D324Y probably damaging Het
Cpne1 A G 2: 156,073,422 *211R probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Khdrbs1 A T 4: 129,725,663 H228Q probably damaging Het
Lrfn1 G A 7: 28,467,407 G742E probably damaging Het
Lrrc45 T A 11: 120,718,447 D377E probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mcoln3 T A 3: 146,133,907 I338N possibly damaging Het
Mep1b G A 18: 21,093,304 G408S probably damaging Het
Pdlim5 C A 3: 142,312,131 Q125H probably damaging Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Pkd1 G A 17: 24,594,486 R4000H probably damaging Het
Smchd1 A T 17: 71,363,038 D1679E probably benign Het
Stac3 C T 10: 127,508,147 R305C probably benign Het
Tex10 A T 4: 48,459,393 probably null Het
Ttc21a T C 9: 119,952,254 Y498H probably benign Het
Txnrd2 T C 16: 18,454,513 F239S probably damaging Het
Vac14 T A 8: 110,634,317 L173Q probably damaging Het
Zfhx4 T A 3: 5,403,654 N2982K probably damaging Het
Other mutations in Ripor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Ripor3 APN 2 167993575 missense probably benign 0.05
IGL01621:Ripor3 APN 2 167997252 missense probably damaging 0.97
IGL01819:Ripor3 APN 2 167980843 missense probably damaging 0.99
IGL01891:Ripor3 APN 2 167983151 missense possibly damaging 0.95
IGL02110:Ripor3 APN 2 167994706 missense possibly damaging 0.95
IGL02270:Ripor3 APN 2 167993496 missense probably damaging 0.97
IGL02403:Ripor3 APN 2 167989330 missense probably damaging 1.00
IGL02445:Ripor3 APN 2 167992762 splice site probably benign
IGL02447:Ripor3 APN 2 167992830 missense probably damaging 0.99
IGL02711:Ripor3 APN 2 168006280 utr 5 prime probably benign
IGL03187:Ripor3 APN 2 167985668 missense possibly damaging 0.64
IGL03304:Ripor3 APN 2 167980928 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0387:Ripor3 UTSW 2 167983772 nonsense probably null
R1457:Ripor3 UTSW 2 167992653 missense probably damaging 1.00
R1481:Ripor3 UTSW 2 168000377 missense possibly damaging 0.95
R1619:Ripor3 UTSW 2 167980845 missense probably damaging 0.96
R2358:Ripor3 UTSW 2 167983865 splice site probably benign
R2431:Ripor3 UTSW 2 167989795 missense probably benign 0.06
R2943:Ripor3 UTSW 2 167983761 missense possibly damaging 0.46
R3730:Ripor3 UTSW 2 167992819 missense probably damaging 1.00
R3731:Ripor3 UTSW 2 167992819 missense probably damaging 1.00
R4084:Ripor3 UTSW 2 167984466 missense possibly damaging 0.55
R4796:Ripor3 UTSW 2 167981340 missense probably damaging 0.97
R4854:Ripor3 UTSW 2 167992813 missense probably benign 0.05
R4934:Ripor3 UTSW 2 167982816 missense probably benign
R4968:Ripor3 UTSW 2 167985117 missense probably benign 0.41
R5662:Ripor3 UTSW 2 167993556 missense probably benign 0.01
R5739:Ripor3 UTSW 2 167981283 missense probably damaging 1.00
R5888:Ripor3 UTSW 2 167997287 missense probably damaging 1.00
R6844:Ripor3 UTSW 2 167993333 splice site probably null
R6969:Ripor3 UTSW 2 167985737 missense probably benign 0.01
R6994:Ripor3 UTSW 2 167997266 missense probably damaging 0.99
R7609:Ripor3 UTSW 2 167984570 missense possibly damaging 0.86
R7818:Ripor3 UTSW 2 167989426 missense probably benign 0.09
R8329:Ripor3 UTSW 2 167983199 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACACACATAGCACACACCACA -3'
(R):5'- TGGCAAGGAGTCTCAGAGTTCC -3'

Sequencing Primer
(F):5'- GCACATACACAGCACATATATACAG -3'
(R):5'- GGAGTCTCAGAGTTCCTTTGAAAGAC -3'
Posted On2015-01-11