Incidental Mutation 'R3000:Smchd1'
ID257264
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene NameSMC hinge domain containing 1
Synonyms4931400A14Rik, MommeD1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R3000 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71344489-71475343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71363038 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1679 (D1679E)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
Predicted Effect probably benign
Transcript: ENSMUST00000127430
AA Change: D1679E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: D1679E

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191623
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank1 A G 8: 23,119,431 K1364E probably damaging Het
Ankrd27 T A 7: 35,608,330 N331K probably damaging Het
Bco2 C A 9: 50,538,929 D324Y probably damaging Het
Cpne1 A G 2: 156,073,422 *211R probably null Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Khdrbs1 A T 4: 129,725,663 H228Q probably damaging Het
Lrfn1 G A 7: 28,467,407 G742E probably damaging Het
Lrrc45 T A 11: 120,718,447 D377E probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mcoln3 T A 3: 146,133,907 I338N possibly damaging Het
Mep1b G A 18: 21,093,304 G408S probably damaging Het
Pdlim5 C A 3: 142,312,131 Q125H probably damaging Het
Peg10 CCAACAACAACAACAACAACAACA CCAACAACAACAACAACAACA 6: 4,754,276 probably benign Het
Pkd1 G A 17: 24,594,486 R4000H probably damaging Het
Ripor3 A T 2: 167,991,180 Y357N probably damaging Het
Stac3 C T 10: 127,508,147 R305C probably benign Het
Tex10 A T 4: 48,459,393 probably null Het
Ttc21a T C 9: 119,952,254 Y498H probably benign Het
Txnrd2 T C 16: 18,454,513 F239S probably damaging Het
Vac14 T A 8: 110,634,317 L173Q probably damaging Het
Zfhx4 T A 3: 5,403,654 N2982K probably damaging Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7068:Smchd1 UTSW 17 71387092 missense probably benign 0.00
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71475301 start gained probably benign
R7898:Smchd1 UTSW 17 71377818 splice site probably null
R7965:Smchd1 UTSW 17 71455626 missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71390453 missense probably benign 0.28
R8359:Smchd1 UTSW 17 71431243 missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71394913 missense probably benign 0.22
R8426:Smchd1 UTSW 17 71448603 missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71407249 missense probably benign 0.18
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCAGACATAGTATGTGCACTGTG -3'
(R):5'- ACCTTGGGACTTAGAGCTTGG -3'

Sequencing Primer
(F):5'- CACATGTGTTCAGAGGACAAATGCTC -3'
(R):5'- GGGACTTAGAGCTTGGTAGTTATTAC -3'
Posted On2015-01-11