Incidental Mutation 'R3003:Suz12'
ID257368
Institutional Source Beutler Lab
Gene Symbol Suz12
Ensembl Gene ENSMUSG00000017548
Gene NameSUZ12 polycomb repressive complex 2 subunit
Synonyms2610028O16Rik, D11Ertd530e
MMRRC Submission 040532-MU
Accession Numbers

Genbank: NM_199196, NM_001163018; MGI: 1261758

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3003 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79993106-80034123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80019761 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 313 (W313R)
Ref Sequence ENSEMBL: ENSMUSP00000126932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017692] [ENSMUST00000163272]
Predicted Effect probably damaging
Transcript: ENSMUST00000017692
AA Change: W336R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017692
Gene: ENSMUSG00000017548
AA Change: W336R

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 5e-3 SMART
ZnF_C2H2 450 473 4.45e0 SMART
Pfam:VEFS-Box 548 682 3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163272
AA Change: W313R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126932
Gene: ENSMUSG00000017548
AA Change: W313R

DomainStartEndE-ValueType
SCOP:d1g66a_ 23 70 6e-3 SMART
ZnF_C2H2 427 450 4.45e0 SMART
Pfam:VEFS-Box 523 660 2.4e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181152
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a core component of the polycomb repressive complex 2 (PRC2) that also includes, at least, embryonic ectoderm development protein (EED) and enhancer of zeste homolog 1 or 2 (EZH1 or EZH2). Through the methyltransferase activity of EZH1 or EZH2, the PRC2 complex methylates Lys9 and Lys27 of histone 3 and Lys26 of histone 1, leading to recruitment of the PRC1 complex, histone 2A ubiquitylation and transcriptional repression of the target genes. This gene product is essential for the activity and integrity of the PRC2 complex, and is required for X chromosome inactivation, stem cell maintenance and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice die during early postimplantation stages with failure of embryonic and extraembyronic tissues and organogenesis. Mice heterozygous for a knock-out allele exhibit abnormal brain and spinal cord development with varying penetrance. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, knock-out(1) Targeted, other(3) Gene trapped(30) Chemically induced(1)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,436,529 V568A probably damaging Het
Acd C T 8: 105,700,281 probably null Het
Acly T C 11: 100,504,227 K469E possibly damaging Het
Adh6b G T 3: 138,357,771 L248F possibly damaging Het
Arhgap8 G T 15: 84,771,830 C344F probably damaging Het
Atg9b G T 5: 24,391,219 D192E probably damaging Het
Ccdc180 A G 4: 45,899,988 D182G probably benign Het
Cep112 A G 11: 108,440,503 E178G probably damaging Het
Clptm1l C T 13: 73,617,756 T471I possibly damaging Het
Csmd1 A G 8: 16,196,170 F1072L probably damaging Het
Eprs T C 1: 185,424,391 probably null Het
Il27ra G T 8: 84,032,031 S499* probably null Het
Klk11 T C 7: 43,776,995 I51T probably damaging Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mprip A G 11: 59,727,555 T91A possibly damaging Het
Pfpl T C 19: 12,430,326 I647T possibly damaging Het
Plxnc1 A T 10: 94,793,218 F1565I probably damaging Het
Rnf17 T C 14: 56,500,547 W1262R probably damaging Het
Rptor G A 11: 119,872,371 R927Q possibly damaging Het
Slitrk5 A G 14: 111,679,582 K213E probably damaging Het
Smarcd1 C A 15: 99,712,184 P432Q probably damaging Het
Stat4 A G 1: 52,102,986 D664G probably damaging Het
Sycp2 T C 2: 178,358,123 Y1020C probably benign Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem81 A G 1: 132,508,014 N186S probably benign Het
Vmn2r98 A G 17: 19,065,863 M208V probably benign Het
Zcchc11 G A 4: 108,512,928 E714K probably damaging Het
Other mutations in Suz12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Suz12 APN 11 79999092 missense probably damaging 0.99
IGL00938:Suz12 APN 11 80007569 splice site probably benign
IGL01902:Suz12 APN 11 80025950 missense probably benign 0.04
IGL02998:Suz12 APN 11 80029323 missense probably damaging 1.00
3-1:Suz12 UTSW 11 79999049 intron probably benign
R0317:Suz12 UTSW 11 79999078 missense probably damaging 1.00
R0453:Suz12 UTSW 11 80030033 missense probably damaging 1.00
R1454:Suz12 UTSW 11 80032113 missense probably benign
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1470:Suz12 UTSW 11 80019732 missense possibly damaging 0.87
R1745:Suz12 UTSW 11 80022096 missense probably damaging 0.99
R1868:Suz12 UTSW 11 80013599 splice site probably null
R1957:Suz12 UTSW 11 79999100 missense probably benign 0.01
R2192:Suz12 UTSW 11 80022198 missense probably damaging 1.00
R3758:Suz12 UTSW 11 80024942 missense probably benign 0.00
R4017:Suz12 UTSW 11 80013466 missense probably damaging 1.00
R4275:Suz12 UTSW 11 80030053 missense probably damaging 1.00
R4366:Suz12 UTSW 11 80002162 intron probably benign
R4487:Suz12 UTSW 11 80032113 missense probably benign
R4663:Suz12 UTSW 11 80013524 missense probably damaging 1.00
R4730:Suz12 UTSW 11 80002162 intron probably benign
R4959:Suz12 UTSW 11 80029231 missense probably damaging 1.00
R5763:Suz12 UTSW 11 80025308 nonsense probably null
R6238:Suz12 UTSW 11 80002180 intron probably benign
R6379:Suz12 UTSW 11 80015188 missense possibly damaging 0.87
R6880:Suz12 UTSW 11 80002172 nonsense probably null
R7122:Suz12 UTSW 11 79993593 missense probably damaging 0.99
R7195:Suz12 UTSW 11 80013483 missense probably damaging 1.00
R7343:Suz12 UTSW 11 80019703 missense probably benign 0.34
R7472:Suz12 UTSW 11 80024975 missense probably benign 0.01
X0023:Suz12 UTSW 11 80029240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGCCTGCTTAACATTTTCCC -3'
(R):5'- TGGGAAAAGGCACTCCACAC -3'

Sequencing Primer
(F):5'- AGCCTGCTTAACATTTTCCCTTTTG -3'
(R):5'- CAACCACAGTAGGTGCAA -3'
Posted On2015-01-11