Incidental Mutation 'R3009:Btnl2'
ID257470
Institutional Source Beutler Lab
Gene Symbol Btnl2
Ensembl Gene ENSMUSG00000024340
Gene Namebutyrophilin-like 2
SynonymsBTLN2, NG9, BTL-II, butyrophylin-like MHC class II associated
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3009 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34354822-34369493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34363518 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 353 (R353C)
Ref Sequence ENSEMBL: ENSMUSP00000137048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025198] [ENSMUST00000178562]
Predicted Effect probably damaging
Transcript: ENSMUST00000025198
AA Change: R353C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025198
Gene: ENSMUSG00000024340
AA Change: R353C

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Blast:IG_like 150 236 4e-12 BLAST
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 361 446 2.6e-6 PFAM
transmembrane domain 457 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178562
AA Change: R353C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137048
Gene: ENSMUSG00000024340
AA Change: R353C

DomainStartEndE-ValueType
IG 35 140 2.16e-8 SMART
Pfam:Ig_3 144 222 5.1e-4 PFAM
Pfam:C2-set_2 146 229 1.8e-6 PFAM
IGv 262 343 2.89e-9 SMART
Pfam:C2-set_2 360 446 3.7e-8 PFAM
Pfam:Ig_2 364 452 4.5e-2 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap12 A G 10: 4,357,891 D1567G probably benign Het
Bmp3 T C 5: 98,879,837 S439P probably damaging Het
Galc T C 12: 98,203,969 D676G probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Gprc6a T C 10: 51,628,296 T151A probably benign Het
Limk2 A G 11: 3,359,046 I104T probably benign Het
Mei1 A G 15: 82,112,525 H585R probably damaging Het
Mpp7 G A 18: 7,461,678 P65L possibly damaging Het
Mtfr1 A T 3: 19,215,586 T133S probably benign Het
Olfr1082 T C 2: 86,594,370 T153A probably benign Het
Olfr190 A G 16: 59,074,987 V31A probably benign Het
Olfr361 T C 2: 37,085,077 I224V probably benign Het
Olfr524 T C 7: 140,202,756 R5G probably benign Het
Prkg1 G A 19: 31,664,112 T57I possibly damaging Het
Sppl2c C T 11: 104,187,315 P314S probably benign Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Urb1 A G 16: 90,774,798 I1041T probably benign Het
Vmn2r72 A T 7: 85,749,642 M501K probably benign Het
Vmn2r91 G A 17: 18,105,455 V112I probably benign Het
Other mutations in Btnl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02251:Btnl2 APN 17 34363239 nonsense probably null
IGL02252:Btnl2 APN 17 34365390 missense possibly damaging 0.82
IGL02651:Btnl2 APN 17 34356222 start codon destroyed probably null 1.00
IGL02892:Btnl2 APN 17 34362668 missense possibly damaging 0.61
IGL02939:Btnl2 APN 17 34361069 missense probably benign 0.02
IGL03098:Btnl2 UTSW 17 34365216 missense probably benign 0.20
R0504:Btnl2 UTSW 17 34358117 missense probably benign 0.17
R0706:Btnl2 UTSW 17 34368662 missense probably benign 0.21
R1460:Btnl2 UTSW 17 34366450 missense probably benign
R1590:Btnl2 UTSW 17 34361140 missense possibly damaging 0.86
R1597:Btnl2 UTSW 17 34363237 missense probably damaging 1.00
R1880:Btnl2 UTSW 17 34365363 missense possibly damaging 0.89
R3160:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3162:Btnl2 UTSW 17 34358065 missense probably damaging 1.00
R3722:Btnl2 UTSW 17 34358135 missense possibly damaging 0.74
R4760:Btnl2 UTSW 17 34363195 missense probably damaging 0.99
R4786:Btnl2 UTSW 17 34363348 missense probably damaging 1.00
R4839:Btnl2 UTSW 17 34365286 nonsense probably null
R5456:Btnl2 UTSW 17 34363321 missense probably benign 0.05
R6959:Btnl2 UTSW 17 34363359 missense possibly damaging 0.47
R7011:Btnl2 UTSW 17 34363513 missense probably damaging 1.00
R7650:Btnl2 UTSW 17 34358129 missense probably damaging 1.00
R7785:Btnl2 UTSW 17 34361163 missense probably benign 0.28
R7822:Btnl2 UTSW 17 34363314 missense possibly damaging 0.91
R7988:Btnl2 UTSW 17 34358275 missense possibly damaging 0.87
R8051:Btnl2 UTSW 17 34363499 missense probably damaging 1.00
R8165:Btnl2 UTSW 17 34368708 missense possibly damaging 0.62
R8272:Btnl2 UTSW 17 34356301 critical splice donor site probably null
Z1177:Btnl2 UTSW 17 34363519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCTATTACCCTGCAGTCCAC -3'
(R):5'- TGTGTACCCAAGGTTGTGCTC -3'

Sequencing Primer
(F):5'- TCCACGTGTATGCAAATGGC -3'
(R):5'- ACCCAAGGTTGTGCTCTTGAAG -3'
Posted On2015-01-11