Incidental Mutation 'R3015:Ppme1'
ID257641
Institutional Source Beutler Lab
Gene Symbol Ppme1
Ensembl Gene ENSMUSG00000030718
Gene Nameprotein phosphatase methylesterase 1
Synonyms1110069N17Rik, PME-1, 2700017M01Rik
MMRRC Submission 040536-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3015 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100326737-100372307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100331877 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 352 (H352R)
Ref Sequence ENSEMBL: ENSMUSP00000032963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032963]
Predicted Effect probably damaging
Transcript: ENSMUST00000032963
AA Change: H352R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032963
Gene: ENSMUSG00000030718
AA Change: H352R

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Hydrolase_4 73 199 5.2e-13 PFAM
Pfam:Abhydrolase_1 77 356 7.4e-17 PFAM
Pfam:Abhydrolase_5 78 259 1.3e-14 PFAM
Pfam:Abhydrolase_6 79 362 2.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207622
Predicted Effect probably benign
Transcript: ENSMUST00000207634
Meta Mutation Damage Score 0.9083 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase methylesterase localized to the nucleus. The encoded protein acts on the protein phosphatase-2A catalytic subunit and supports the ERK pathway through dephosphorylation of regulatory proteins. It plays a role in malignant glioma progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: Targeted disruption of this gene causes virtual loss of the demethylated form of phosphoprotein phosphatase 2A in the nervous system and peripheral tissues. Homozygous null mice fail to initiate normal breathing or suckling behavior and die within the first day of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,875,462 F76Y probably damaging Het
Adamts9 T C 6: 92,872,932 H380R probably benign Het
Aff3 A T 1: 38,210,568 I486N probably benign Het
Cfap44 A C 16: 44,410,469 D271A probably benign Het
D430042O09Rik T A 7: 125,866,340 H1321Q probably damaging Het
Dbndd2 T A 2: 164,488,350 V34D probably damaging Het
Erc2 T A 14: 28,011,775 probably null Het
Fam159b T A 13: 104,858,391 I83F possibly damaging Het
Fcgbp T C 7: 28,075,413 probably benign Het
Frem3 T C 8: 80,690,773 S2036P probably damaging Het
Golph3l A G 3: 95,591,713 probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ifrd2 G A 9: 107,590,022 G60S probably null Het
Ints9 T A 14: 64,950,278 W3R probably benign Het
Jmjd1c A G 10: 67,157,932 E64G probably damaging Het
Matn3 A C 12: 8,952,217 Q143P probably damaging Het
Myo18a A T 11: 77,859,020 probably benign Het
Nop9 T C 14: 55,751,174 S358P probably benign Het
Pard3b T C 1: 62,344,878 S801P probably damaging Het
Pax2 T C 19: 44,816,024 F268L probably damaging Het
Pik3r1 A G 13: 101,687,263 I538T probably damaging Het
Plekha8 T C 6: 54,622,122 S214P probably benign Het
Ppp1r26 A C 2: 28,452,302 D648A probably damaging Het
Prom1 C A 5: 44,034,391 V337F probably damaging Het
Rapgef4 T C 2: 72,198,373 I378T probably damaging Het
Rnf115 T C 3: 96,754,359 S43P probably damaging Het
Rnf216 A G 5: 143,075,725 probably null Het
Scn7a G T 2: 66,699,896 Q702K probably benign Het
Slc2a1 T A 4: 119,132,143 N13K probably damaging Het
Tnr A G 1: 159,888,259 I864V probably benign Het
Tspyl3 A T 2: 153,224,730 M196K probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Umod T C 7: 119,472,540 D326G probably damaging Het
Upf2 A G 2: 5,976,079 D492G unknown Het
Vash1 A G 12: 86,685,420 T126A probably benign Het
Vsig10l T A 7: 43,467,457 I574K possibly damaging Het
Other mutations in Ppme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Ppme1 APN 7 100333932 missense probably damaging 1.00
IGL02957:Ppme1 APN 7 100338440 missense possibly damaging 0.93
R0328:Ppme1 UTSW 7 100333975 splice site probably null
R4042:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R4090:Ppme1 UTSW 7 100347837 missense possibly damaging 0.85
R4987:Ppme1 UTSW 7 100345071 missense probably benign 0.01
R5579:Ppme1 UTSW 7 100344975 missense probably damaging 1.00
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6035:Ppme1 UTSW 7 100354795 nonsense probably null
R6374:Ppme1 UTSW 7 100341065 missense probably damaging 1.00
R6462:Ppme1 UTSW 7 100338392 missense probably benign 0.01
R7092:Ppme1 UTSW 7 100371822 start codon destroyed probably null 0.53
R7468:Ppme1 UTSW 7 100341862 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGAAGACCTTAGCCACAGGG -3'
(R):5'- CAACATGGGTCCAGTTACACTC -3'

Sequencing Primer
(F):5'- GGTACCAGCAGCTCTTCAG -3'
(R):5'- TACACTCATCAGACTATCCTGGGGG -3'
Posted On2015-01-11