Incidental Mutation 'R3015:Matn3'
ID 257650
Institutional Source Beutler Lab
Gene Symbol Matn3
Ensembl Gene ENSMUSG00000020583
Gene Name matrilin 3
Synonyms
MMRRC Submission 040536-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.102) question?
Stock # R3015 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 8997929-9022028 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 9002217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 143 (Q143P)
Ref Sequence ENSEMBL: ENSMUSP00000020899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020899]
AlphaFold O35701
Predicted Effect probably damaging
Transcript: ENSMUST00000020899
AA Change: Q143P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020899
Gene: ENSMUSG00000020583
AA Change: Q143P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 76 255 5.06e-51 SMART
EGF 257 300 2.02e-1 SMART
EGF 304 342 4.1e-2 SMART
EGF 346 384 4.22e-4 SMART
EGF 388 426 1.21e-4 SMART
Matrilin_ccoil 433 479 8.93e-14 SMART
Meta Mutation Damage Score 0.6363 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 T C 6: 92,849,913 (GRCm39) H380R probably benign Het
Aff3 A T 1: 38,249,649 (GRCm39) I486N probably benign Het
Bltp1 T A 3: 36,929,611 (GRCm39) F76Y probably damaging Het
Cfap44 A C 16: 44,230,832 (GRCm39) D271A probably benign Het
Dbndd2 T A 2: 164,330,270 (GRCm39) V34D probably damaging Het
Erc2 T A 14: 27,733,732 (GRCm39) probably null Het
Fcgbp T C 7: 27,774,838 (GRCm39) probably benign Het
Frem3 T C 8: 81,417,402 (GRCm39) S2036P probably damaging Het
Golph3l A G 3: 95,499,024 (GRCm39) probably benign Het
Grm7 G T 6: 110,623,309 (GRCm39) V161F probably damaging Het
Ifrd2 G A 9: 107,467,221 (GRCm39) G60S probably null Het
Ints9 T A 14: 65,187,727 (GRCm39) W3R probably benign Het
Jmjd1c A G 10: 66,993,711 (GRCm39) E64G probably damaging Het
Katnip T A 7: 125,465,512 (GRCm39) H1321Q probably damaging Het
Myo18a A T 11: 77,749,846 (GRCm39) probably benign Het
Nop9 T C 14: 55,988,631 (GRCm39) S358P probably benign Het
Pard3b T C 1: 62,384,037 (GRCm39) S801P probably damaging Het
Pax2 T C 19: 44,804,463 (GRCm39) F268L probably damaging Het
Pik3r1 A G 13: 101,823,771 (GRCm39) I538T probably damaging Het
Plekha8 T C 6: 54,599,107 (GRCm39) S214P probably benign Het
Ppme1 T C 7: 99,981,084 (GRCm39) H352R probably damaging Het
Ppp1r26 A C 2: 28,342,314 (GRCm39) D648A probably damaging Het
Prom1 C A 5: 44,191,733 (GRCm39) V337F probably damaging Het
Rapgef4 T C 2: 72,028,717 (GRCm39) I378T probably damaging Het
Rnf115 T C 3: 96,661,675 (GRCm39) S43P probably damaging Het
Rnf216 A G 5: 143,061,480 (GRCm39) probably null Het
Scn7a G T 2: 66,530,240 (GRCm39) Q702K probably benign Het
Shisal2b T A 13: 104,994,899 (GRCm39) I83F possibly damaging Het
Slc2a1 T A 4: 118,989,340 (GRCm39) N13K probably damaging Het
Tnr A G 1: 159,715,829 (GRCm39) I864V probably benign Het
Tspyl3 A T 2: 153,066,650 (GRCm39) M196K probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Umod T C 7: 119,071,763 (GRCm39) D326G probably damaging Het
Upf2 A G 2: 5,980,890 (GRCm39) D492G unknown Het
Vash1 A G 12: 86,732,194 (GRCm39) T126A probably benign Het
Vsig10l T A 7: 43,116,881 (GRCm39) I574K possibly damaging Het
Other mutations in Matn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Matn3 APN 12 9,002,091 (GRCm39) missense probably damaging 0.98
IGL02138:Matn3 APN 12 9,017,638 (GRCm39) missense possibly damaging 0.93
IGL02442:Matn3 APN 12 9,017,678 (GRCm39) nonsense probably null
IGL02736:Matn3 APN 12 9,005,422 (GRCm39) missense possibly damaging 0.53
R0091:Matn3 UTSW 12 9,002,105 (GRCm39) missense probably damaging 0.98
R0585:Matn3 UTSW 12 9,011,103 (GRCm39) splice site probably benign
R0615:Matn3 UTSW 12 9,013,594 (GRCm39) missense probably damaging 1.00
R1424:Matn3 UTSW 12 9,011,132 (GRCm39) missense possibly damaging 0.91
R1571:Matn3 UTSW 12 9,005,466 (GRCm39) missense probably damaging 1.00
R1844:Matn3 UTSW 12 9,017,662 (GRCm39) missense possibly damaging 0.90
R1865:Matn3 UTSW 12 9,002,041 (GRCm39) missense probably damaging 1.00
R1977:Matn3 UTSW 12 9,011,110 (GRCm39) splice site probably benign
R3018:Matn3 UTSW 12 9,013,578 (GRCm39) missense probably benign 0.02
R5180:Matn3 UTSW 12 9,005,374 (GRCm39) missense probably benign 0.38
R5308:Matn3 UTSW 12 9,002,308 (GRCm39) frame shift probably null
R5616:Matn3 UTSW 12 8,998,195 (GRCm39) missense probably benign
R5816:Matn3 UTSW 12 9,020,571 (GRCm39) missense probably damaging 1.00
R5849:Matn3 UTSW 12 9,008,829 (GRCm39) missense probably benign 0.10
R7065:Matn3 UTSW 12 9,002,472 (GRCm39) missense probably damaging 0.99
R7206:Matn3 UTSW 12 9,011,170 (GRCm39) missense probably benign 0.01
R8512:Matn3 UTSW 12 9,011,183 (GRCm39) missense probably benign 0.11
R8737:Matn3 UTSW 12 9,017,665 (GRCm39) missense possibly damaging 0.90
R8951:Matn3 UTSW 12 9,002,172 (GRCm39) missense probably damaging 0.99
R9022:Matn3 UTSW 12 9,002,355 (GRCm39) missense probably damaging 1.00
R9328:Matn3 UTSW 12 9,002,033 (GRCm39) missense possibly damaging 0.78
RF001:Matn3 UTSW 12 9,008,797 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCATCATTGATAGTTCTCGTAGCG -3'
(R):5'- CATACAGCTCAATGCCAGATGC -3'

Sequencing Primer
(F):5'- ATAGTTCTCGTAGCGTCCGGC -3'
(R):5'- TCGAGCAGCCACCTCATTC -3'
Posted On 2015-01-11