Incidental Mutation 'R3015:Matn3'
ID257650
Institutional Source Beutler Lab
Gene Symbol Matn3
Ensembl Gene ENSMUSG00000020583
Gene Namematrilin 3
Synonyms
MMRRC Submission 040536-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R3015 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location8947929-8972028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 8952217 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 143 (Q143P)
Ref Sequence ENSEMBL: ENSMUSP00000020899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020899]
Predicted Effect probably damaging
Transcript: ENSMUST00000020899
AA Change: Q143P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020899
Gene: ENSMUSG00000020583
AA Change: Q143P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 76 255 5.06e-51 SMART
EGF 257 300 2.02e-1 SMART
EGF 304 342 4.1e-2 SMART
EGF 346 384 4.22e-4 SMART
EGF 388 426 1.21e-4 SMART
Matrilin_ccoil 433 479 8.93e-14 SMART
Meta Mutation Damage Score 0.6363 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains two von Willebrand factor A domains; it is present in the cartilage extracellular matrix and has a role in the development and homeostasis of cartilage and bone. Mutations in this gene result in multiple epiphyseal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,875,462 F76Y probably damaging Het
Adamts9 T C 6: 92,872,932 H380R probably benign Het
Aff3 A T 1: 38,210,568 I486N probably benign Het
Cfap44 A C 16: 44,410,469 D271A probably benign Het
D430042O09Rik T A 7: 125,866,340 H1321Q probably damaging Het
Dbndd2 T A 2: 164,488,350 V34D probably damaging Het
Erc2 T A 14: 28,011,775 probably null Het
Fam159b T A 13: 104,858,391 I83F possibly damaging Het
Fcgbp T C 7: 28,075,413 probably benign Het
Frem3 T C 8: 80,690,773 S2036P probably damaging Het
Golph3l A G 3: 95,591,713 probably benign Het
Grm7 G T 6: 110,646,348 V161F probably damaging Het
Ifrd2 G A 9: 107,590,022 G60S probably null Het
Ints9 T A 14: 64,950,278 W3R probably benign Het
Jmjd1c A G 10: 67,157,932 E64G probably damaging Het
Myo18a A T 11: 77,859,020 probably benign Het
Nop9 T C 14: 55,751,174 S358P probably benign Het
Pard3b T C 1: 62,344,878 S801P probably damaging Het
Pax2 T C 19: 44,816,024 F268L probably damaging Het
Pik3r1 A G 13: 101,687,263 I538T probably damaging Het
Plekha8 T C 6: 54,622,122 S214P probably benign Het
Ppme1 T C 7: 100,331,877 H352R probably damaging Het
Ppp1r26 A C 2: 28,452,302 D648A probably damaging Het
Prom1 C A 5: 44,034,391 V337F probably damaging Het
Rapgef4 T C 2: 72,198,373 I378T probably damaging Het
Rnf115 T C 3: 96,754,359 S43P probably damaging Het
Rnf216 A G 5: 143,075,725 probably null Het
Scn7a G T 2: 66,699,896 Q702K probably benign Het
Slc2a1 T A 4: 119,132,143 N13K probably damaging Het
Tnr A G 1: 159,888,259 I864V probably benign Het
Tspyl3 A T 2: 153,224,730 M196K probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Umod T C 7: 119,472,540 D326G probably damaging Het
Upf2 A G 2: 5,976,079 D492G unknown Het
Vash1 A G 12: 86,685,420 T126A probably benign Het
Vsig10l T A 7: 43,467,457 I574K possibly damaging Het
Other mutations in Matn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Matn3 APN 12 8952091 missense probably damaging 0.98
IGL02138:Matn3 APN 12 8967638 missense possibly damaging 0.93
IGL02442:Matn3 APN 12 8967678 nonsense probably null
IGL02736:Matn3 APN 12 8955422 missense possibly damaging 0.53
R0091:Matn3 UTSW 12 8952105 missense probably damaging 0.98
R0585:Matn3 UTSW 12 8961103 splice site probably benign
R0615:Matn3 UTSW 12 8963594 missense probably damaging 1.00
R1424:Matn3 UTSW 12 8961132 missense possibly damaging 0.91
R1571:Matn3 UTSW 12 8955466 missense probably damaging 1.00
R1844:Matn3 UTSW 12 8967662 missense possibly damaging 0.90
R1865:Matn3 UTSW 12 8952041 missense probably damaging 1.00
R1977:Matn3 UTSW 12 8961110 splice site probably benign
R3018:Matn3 UTSW 12 8963578 missense probably benign 0.02
R5180:Matn3 UTSW 12 8955374 missense probably benign 0.38
R5308:Matn3 UTSW 12 8952308 frame shift probably null
R5616:Matn3 UTSW 12 8948195 missense probably benign
R5816:Matn3 UTSW 12 8970571 missense probably damaging 1.00
R5849:Matn3 UTSW 12 8958829 missense probably benign 0.10
R7065:Matn3 UTSW 12 8952472 missense probably damaging 0.99
R7206:Matn3 UTSW 12 8961170 missense probably benign 0.01
RF001:Matn3 UTSW 12 8958797 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCATCATTGATAGTTCTCGTAGCG -3'
(R):5'- CATACAGCTCAATGCCAGATGC -3'

Sequencing Primer
(F):5'- ATAGTTCTCGTAGCGTCCGGC -3'
(R):5'- TCGAGCAGCCACCTCATTC -3'
Posted On2015-01-11