Incidental Mutation 'R2986:AI661453'
ID257808
Institutional Source Beutler Lab
Gene Symbol AI661453
Ensembl Gene ENSMUSG00000034382
Gene Nameexpressed sequence AI661453
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2986 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location47436615-47470638 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 47466772 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 474 (C474*)
Ref Sequence ENSEMBL: ENSMUSP00000120133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000150819]
Predicted Effect probably benign
Transcript: ENSMUST00000037701
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150819
AA Change: C474*
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382
AA Change: C474*

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,520,517 C364F probably damaging Het
Arhgap18 A G 10: 26,854,907 T122A probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Bbs4 A G 9: 59,341,195 L75P probably damaging Het
Cenpl C T 1: 161,083,467 probably benign Het
Cnnm4 G A 1: 36,472,372 R227H possibly damaging Het
Eif4g2 T C 7: 111,078,483 E141G probably damaging Het
Fat3 A G 9: 15,992,128 C3024R probably damaging Het
Gss T C 2: 155,587,443 D43G probably benign Het
Hmcn2 A T 2: 31,360,998 D824V probably damaging Het
Slc15a1 C T 14: 121,489,809 D116N probably benign Het
Slc34a1 A G 13: 55,403,329 D190G probably benign Het
Ttll11 G A 2: 35,817,738 S519L probably benign Het
Uhrf1bp1l T A 10: 89,806,069 V1034E probably benign Het
Wdr49 T C 3: 75,382,040 M184V probably benign Het
Zfp384 T A 6: 125,024,896 V113E possibly damaging Het
Other mutations in AI661453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:AI661453 APN 17 47466623 intron probably benign
IGL01995:AI661453 APN 17 47468517 intron probably benign
IGL02171:AI661453 APN 17 47466996 intron probably benign
IGL02411:AI661453 APN 17 47467338 intron probably benign
IGL02422:AI661453 APN 17 47467092 intron probably benign
IGL02609:AI661453 APN 17 47468372 intron probably benign
IGL02888:AI661453 APN 17 47467404 intron probably benign
IGL03024:AI661453 APN 17 47446588 missense probably damaging 1.00
R0077:AI661453 UTSW 17 47469362 intron probably benign
R0092:AI661453 UTSW 17 47467515 intron probably benign
R0144:AI661453 UTSW 17 47469299 intron probably benign
R0330:AI661453 UTSW 17 47446646 missense probably damaging 1.00
R0590:AI661453 UTSW 17 47467074 intron probably benign
R0839:AI661453 UTSW 17 47436827 missense probably null 0.97
R1350:AI661453 UTSW 17 47467928 nonsense probably null
R1436:AI661453 UTSW 17 47466702 intron probably benign
R1439:AI661453 UTSW 17 47466662 intron probably benign
R1643:AI661453 UTSW 17 47467866 intron probably benign
R1994:AI661453 UTSW 17 47467034 intron probably benign
R2145:AI661453 UTSW 17 47466098 intron probably benign
R4398:AI661453 UTSW 17 47468117 intron probably benign
R4809:AI661453 UTSW 17 47467187 intron probably benign
R4913:AI661453 UTSW 17 47468555 nonsense probably null
R4972:AI661453 UTSW 17 47466399 intron probably benign
R6430:AI661453 UTSW 17 47466797 intron probably benign
R6687:AI661453 UTSW 17 47467002 intron probably benign
R7494:AI661453 UTSW 17 47468180 missense unknown
R7598:AI661453 UTSW 17 47466120 missense unknown
R7635:AI661453 UTSW 17 47467751 missense unknown
Predicted Primers PCR Primer
(F):5'- CCCAGACAAATGGACAAGCTGG -3'
(R):5'- CTGGGCAATGTAGTCCACAG -3'

Sequencing Primer
(F):5'- TGCCCTCTACCGAGCTG -3'
(R):5'- TAGTCCACAGGGGGTAGGACC -3'
Posted On2015-01-11