Incidental Mutation 'R3027:Spo11'
ID 265840
Institutional Source Beutler Lab
Gene Symbol Spo11
Ensembl Gene ENSMUSG00000005883
Gene Name SPO11 initiator of meiotic double stranded breaks
Synonyms Spo11a, Spo11b
MMRRC Submission 040543-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3027 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 172819493-172835369 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 172827736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 146 (Y146H)
Ref Sequence ENSEMBL: ENSMUSP00000104753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050442] [ENSMUST00000109125] [ENSMUST00000109126]
AlphaFold Q9WTK8
Predicted Effect probably damaging
Transcript: ENSMUST00000050442
AA Change: Y184H

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059056
Gene: ENSMUSG00000005883
AA Change: Y184H

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 6.3e-28 PFAM
Pfam:TP6A_N 107 170 3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109125
AA Change: Y146H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104753
Gene: ENSMUSG00000005883
AA Change: Y146H

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1e-30 PFAM
Pfam:TP6A_N 66 133 3.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109126
AA Change: Y159H

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104754
Gene: ENSMUSG00000005883
AA Change: Y159H

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1.1e-30 PFAM
Pfam:TP6A_N 102 146 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156471
Meta Mutation Damage Score 0.5154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Mutant males exhibit loss of spermatocytes in early prophase, while mutant females exhibit oocyte loss soon after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 T C 5: 62,827,240 (GRCm39) T993A probably damaging Het
Arhgap18 G A 10: 26,722,092 (GRCm39) G21D probably benign Het
Cluap1 T A 16: 3,729,396 (GRCm39) C84* probably null Het
Dnmt3a T A 12: 3,899,626 (GRCm39) probably null Het
Etaa1 T C 11: 17,897,886 (GRCm39) D146G probably damaging Het
Fam227a T C 15: 79,532,934 (GRCm39) probably null Het
Htt T A 5: 34,977,439 (GRCm39) I775N possibly damaging Het
Itgax C A 7: 127,747,744 (GRCm39) Y1053* probably null Het
Kif21a T A 15: 90,856,845 (GRCm39) N583Y probably damaging Het
Lrp1b T A 2: 40,760,283 (GRCm39) E2995V probably benign Het
Or1ad8 G A 11: 50,897,879 (GRCm39) V27M possibly damaging Het
Or5h22 C T 16: 58,895,330 (GRCm39) V38I probably benign Het
Or6aa1 T C 7: 86,043,761 (GRCm39) N315S probably benign Het
Or8k39 C T 2: 86,563,930 (GRCm39) V9M possibly damaging Het
Otos A T 1: 92,572,076 (GRCm39) H83Q probably damaging Het
Pramel7 A G 2: 87,321,747 (GRCm39) M96T probably benign Het
Ptprz1 T A 6: 23,016,196 (GRCm39) S1680T possibly damaging Het
Rad50 A G 11: 53,586,208 (GRCm39) S263P probably benign Het
Resf1 T C 6: 149,230,533 (GRCm39) L1193P probably benign Het
Retreg2 A G 1: 75,123,088 (GRCm39) S339G probably damaging Het
Schip1 G A 3: 68,401,943 (GRCm39) A7T probably damaging Het
Shkbp1 A C 7: 27,042,818 (GRCm39) S540A probably benign Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Socs1 T C 16: 10,602,578 (GRCm39) D53G possibly damaging Het
Spag9 G T 11: 93,977,203 (GRCm39) R103L probably null Het
Spc24 AGAGGTAGTCACTGA AGA 9: 21,667,511 (GRCm39) probably null Het
Tmem25 T C 9: 44,709,511 (GRCm39) probably null Het
Ttyh1 A G 7: 4,122,721 (GRCm39) D23G probably benign Het
Vrk3 C T 7: 44,424,866 (GRCm39) T427M probably benign Het
Zfp513 A G 5: 31,356,673 (GRCm39) S540P possibly damaging Het
Zfp808 A T 13: 62,319,404 (GRCm39) H211L probably benign Het
Other mutations in Spo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Spo11 APN 2 172,830,825 (GRCm39) critical splice donor site probably null
IGL02080:Spo11 APN 2 172,831,188 (GRCm39) missense probably damaging 1.00
IGL02309:Spo11 APN 2 172,821,744 (GRCm39) missense probably damaging 0.98
R4031:Spo11 UTSW 2 172,828,625 (GRCm39) splice site probably benign
R5000:Spo11 UTSW 2 172,831,193 (GRCm39) missense probably damaging 1.00
R5443:Spo11 UTSW 2 172,831,152 (GRCm39) splice site probably benign
R7185:Spo11 UTSW 2 172,823,985 (GRCm39) splice site probably null
R7486:Spo11 UTSW 2 172,825,870 (GRCm39) missense probably benign 0.01
R7565:Spo11 UTSW 2 172,833,864 (GRCm39) missense possibly damaging 0.65
R7958:Spo11 UTSW 2 172,825,815 (GRCm39) missense probably benign 0.00
R8120:Spo11 UTSW 2 172,827,251 (GRCm39) missense probably damaging 0.98
R9776:Spo11 UTSW 2 172,833,904 (GRCm39) missense possibly damaging 0.92
X0061:Spo11 UTSW 2 172,834,843 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCAGGGACCTTATCAAATG -3'
(R):5'- ACACACGGTTCCTTCATCTGG -3'

Sequencing Primer
(F):5'- CCTAAATACCCTTACATGTTTTCTCC -3'
(R):5'- GGTGACAGTACTTGCCACACATG -3'
Posted On 2015-02-05