Incidental Mutation 'R3726:Daam2'
ID270811
Institutional Source Beutler Lab
Gene Symbol Daam2
Ensembl Gene ENSMUSG00000040260
Gene Namedishevelled associated activator of morphogenesis 2
Synonyms
MMRRC Submission 040717-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3726 (G1)
Quality Score188
Status Validated
Chromosome17
Chromosomal Location49456022-49564343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49469738 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 773 (D773V)
Ref Sequence ENSEMBL: ENSMUSP00000052085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057610]
Predicted Effect probably damaging
Transcript: ENSMUST00000057610
AA Change: D773V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052085
Gene: ENSMUSG00000040260
AA Change: D773V

DomainStartEndE-ValueType
Drf_GBD 40 228 4.89e-61 SMART
Drf_FH3 231 429 1.19e-73 SMART
Blast:FH2 476 513 4e-10 BLAST
low complexity region 514 534 N/A INTRINSIC
low complexity region 539 576 N/A INTRINSIC
FH2 595 1085 7.36e-99 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224954
Meta Mutation Damage Score 0.7936 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype PHENOTYPE: Homozygous KO in combination with homozygous Daam1 conditional KO increases the severity of the heart phenotype (abnormal ventricular morphology and pressure) of the Daam1 single KO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402K13Rik AGAGGAG AGAG X: 9,105,103 probably benign Het
Caap1 A T 4: 94,501,143 V318D probably damaging Het
Camsap3 T C 8: 3,603,785 L485P probably damaging Het
Ccsap T C 8: 123,859,361 E17G possibly damaging Het
Cdk5rap2 C A 4: 70,235,437 K1716N possibly damaging Het
Coq3 T C 4: 21,892,941 probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam209 T C 2: 172,473,995 S97P probably benign Het
Fam50b G A 13: 34,746,886 R115H probably damaging Het
Fbxo31 A G 8: 121,578,509 F83L probably damaging Het
Fsip2 G T 2: 82,988,967 A5015S possibly damaging Het
Galnt13 A G 2: 55,098,657 H497R probably damaging Het
Ggnbp2 A G 11: 84,854,094 C201R possibly damaging Het
Gm8730 T C 8: 102,865,032 noncoding transcript Het
Gsr A G 8: 33,671,537 K124R probably benign Het
Hdgf T C 3: 87,914,497 S140P probably benign Het
Iqcg C T 16: 33,029,041 E292K probably damaging Het
Lamb1 C T 12: 31,321,075 A1375V probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Lonp1 A G 17: 56,618,310 probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr805 A T 10: 129,723,115 V143D probably damaging Het
Pcdhb9 T C 18: 37,401,601 L216P possibly damaging Het
Ppp3cb A G 14: 20,530,942 probably null Het
Ptprm G A 17: 66,956,860 P464L possibly damaging Het
Rars2 A G 4: 34,645,787 T235A probably benign Het
Rimkla A T 4: 119,477,789 probably null Het
Rnf216 A T 5: 143,027,946 I708N probably damaging Het
Six5 T A 7: 19,096,930 V494E possibly damaging Het
Slc43a2 A G 11: 75,543,154 probably benign Het
Slmap C A 14: 26,427,242 R671S probably damaging Het
Smarcal1 T C 1: 72,626,596 F751S possibly damaging Het
Sptan1 G A 2: 30,018,419 D1711N possibly damaging Het
Sptssa T C 12: 54,656,395 E30G probably damaging Het
Taf1c A G 8: 119,603,070 F111L probably damaging Het
Thbs1 A G 2: 118,114,710 I255V probably benign Het
Tmem19 A G 10: 115,359,770 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmod1 T C 4: 46,097,026 V273A probably benign Het
Trpm8 A T 1: 88,328,196 Y191F probably benign Het
Ube4a T C 9: 44,933,323 I934V probably damaging Het
Vpreb3 G A 10: 75,943,291 probably null Het
Vwf G T 6: 125,677,948 probably benign Het
Wdr53 T C 16: 32,256,720 C248R probably benign Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Daam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Daam2 APN 17 49490304 missense possibly damaging 0.82
IGL02373:Daam2 APN 17 49473380 missense probably damaging 1.00
IGL02626:Daam2 APN 17 49490254 missense possibly damaging 0.46
IGL02793:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL02861:Daam2 APN 17 49469427 missense probably damaging 1.00
IGL02875:Daam2 APN 17 49464028 missense probably damaging 1.00
IGL03370:Daam2 APN 17 49486501 missense probably benign 0.19
R0145:Daam2 UTSW 17 49480778 missense probably benign
R0310:Daam2 UTSW 17 49463924 critical splice donor site probably null
R0362:Daam2 UTSW 17 49480785 splice site probably null
R0423:Daam2 UTSW 17 49469421 nonsense probably null
R0883:Daam2 UTSW 17 49498883 utr 5 prime probably benign
R0928:Daam2 UTSW 17 49488227 missense probably benign 0.30
R1444:Daam2 UTSW 17 49480751 missense possibly damaging 0.89
R1559:Daam2 UTSW 17 49496120 splice site probably benign
R1733:Daam2 UTSW 17 49490203 missense possibly damaging 0.60
R1919:Daam2 UTSW 17 49485457 missense probably benign 0.00
R1930:Daam2 UTSW 17 49462213 splice site probably null
R1968:Daam2 UTSW 17 49483060 missense probably damaging 1.00
R2520:Daam2 UTSW 17 49480757 nonsense probably null
R3004:Daam2 UTSW 17 49460654 missense probably damaging 0.98
R3854:Daam2 UTSW 17 49458596 missense probably benign
R4833:Daam2 UTSW 17 49490145 missense possibly damaging 0.91
R4878:Daam2 UTSW 17 49460710 missense probably damaging 1.00
R5015:Daam2 UTSW 17 49476522 missense probably damaging 1.00
R5106:Daam2 UTSW 17 49476461 missense probably damaging 1.00
R5184:Daam2 UTSW 17 49494391 missense possibly damaging 0.50
R5419:Daam2 UTSW 17 49480754 missense possibly damaging 0.95
R5529:Daam2 UTSW 17 49459057 missense probably benign
R5974:Daam2 UTSW 17 49464473 missense probably damaging 1.00
R5979:Daam2 UTSW 17 49459204 missense possibly damaging 0.47
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6032:Daam2 UTSW 17 49486497 missense probably damaging 1.00
R6050:Daam2 UTSW 17 49486502 missense possibly damaging 0.78
R6180:Daam2 UTSW 17 49469666 missense probably damaging 0.99
R6225:Daam2 UTSW 17 49494439 missense probably damaging 0.98
R6385:Daam2 UTSW 17 49463936 missense probably damaging 1.00
R6426:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6427:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6428:Daam2 UTSW 17 49469376 missense probably damaging 1.00
R6539:Daam2 UTSW 17 49469711 missense probably damaging 1.00
R7090:Daam2 UTSW 17 49482945 missense probably damaging 0.99
R7108:Daam2 UTSW 17 49460674 missense probably damaging 1.00
R7487:Daam2 UTSW 17 49486482 missense probably benign 0.03
R7599:Daam2 UTSW 17 49480727 nonsense probably null
R7763:Daam2 UTSW 17 49490022 missense probably benign 0.04
V1662:Daam2 UTSW 17 49464601 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GACAAAGTCACAGGTGAGCC -3'
(R):5'- ATGGGTAGAACAGGTTGGCC -3'

Sequencing Primer
(F):5'- AGAGCTGCTGCCTGAATC -3'
(R):5'- CCTCAAAGTTTGGTATGTAGCCCAG -3'
Posted On2015-03-18