Mutagenetix > Incidental Mutation

Incidental Mutation 'R3775:Dcdc5'

273536

Institutional Source

Beutler Lab

Gene Symbol

Dcdc5

Ensembl Gene

ENSMUSG00000074981

Gene Name

doublecortin domain containing 5

Synonyms

4732421G10Rik, EG436559

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R3775 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105833674-106236496 bp(+) (GRCm39)

Type of Mutation

exon

DNA Base Change (assembly)

C to A at 106202738 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152776

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found, but the full-length nature of some variants is not determined. [provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	G	19: 8,986,387 (GRCm39)	E2557G	possibly damaging	Het
Arid1a	A	G	4: 133,414,075 (GRCm39)	S1248P	unknown	Het
C2cd3	T	C	7: 100,081,205 (GRCm39)	L1327S	probably damaging	Het
Ccnh	T	C	13: 85,354,243 (GRCm39)		probably benign	Het
Eprs1	T	C	1: 185,105,205 (GRCm39)	F160S	probably damaging	Het
F9	A	G	X: 59,064,345 (GRCm39)	I190V	probably benign	Het
Fam185a	C	A	5: 21,660,804 (GRCm39)	A273D	probably damaging	Het
Fhod1	G	A	8: 106,058,270 (GRCm39)		probably benign	Het
Gpat4	G	A	8: 23,670,171 (GRCm39)	P286L	probably damaging	Het
Hipk2	T	C	6: 38,720,029 (GRCm39)	D534G	probably damaging	Het
Ints6l	T	C	X: 55,526,731 (GRCm39)	L220S	probably damaging	Het
Kat7	T	C	11: 95,182,357 (GRCm39)	T250A	probably benign	Het
Kif23	G	A	9: 61,832,274 (GRCm39)	S623L	probably benign	Het
Krt32	A	G	11: 99,978,947 (GRCm39)	C36R	probably benign	Het
Megf10	G	A	18: 57,410,177 (GRCm39)	G653S	probably damaging	Het
Mpp3	G	T	11: 101,914,193 (GRCm39)	S134*	probably null	Het
Msh6	G	T	17: 88,293,609 (GRCm39)	R788L	probably damaging	Het
Mxi1	C	A	19: 53,360,160 (GRCm39)	A294E	probably benign	Het
Naip5	T	C	13: 100,359,883 (GRCm39)	E451G	probably benign	Het
Naip5	T	C	13: 100,359,902 (GRCm39)	I445V	probably benign	Het
Nlrp1b	T	C	11: 71,047,126 (GRCm39)		probably benign	Het
Npy1r	T	C	8: 67,157,502 (GRCm39)	F271L	possibly damaging	Het
Nup160	G	T	2: 90,552,420 (GRCm39)	C1132F	probably benign	Het
Or13p3	C	T	4: 118,567,351 (GRCm39)	T249I	probably damaging	Het
Or1o2	T	A	17: 37,543,121 (GRCm39)	I47F	probably damaging	Het
Pcdhga5	A	G	18: 37,828,167 (GRCm39)	E205G	possibly damaging	Het
Pdgfc	A	G	3: 81,048,858 (GRCm39)	T89A	probably damaging	Het
Pecr	A	G	1: 72,298,530 (GRCm39)	F297L	probably benign	Het
Pgr15l	G	T	X: 96,120,747 (GRCm39)	R181M	probably damaging	Het
Pomgnt1	G	A	4: 116,011,325 (GRCm39)	R230H	probably damaging	Het
Ppm1d	T	C	11: 85,227,993 (GRCm39)	I303T	probably damaging	Het
Ptprc	T	G	1: 137,992,511 (GRCm39)	Q1205H	probably damaging	Het
Rnf112	A	T	11: 61,341,011 (GRCm39)		probably benign	Het
Slc25a13	T	A	6: 6,109,288 (GRCm39)	Q358L	probably damaging	Het
Slc25a19	A	G	11: 115,506,285 (GRCm39)	Y303H	probably damaging	Het
Sympk	T	C	7: 18,769,880 (GRCm39)	F186L	probably damaging	Het
Tek	A	G	4: 94,692,549 (GRCm39)	D219G	probably benign	Het
Tmem59l	A	G	8: 70,939,951 (GRCm39)	L6S	unknown	Het
Tnik	T	C	3: 28,692,568 (GRCm39)	Y820H	probably damaging	Het
Tnrc6c	C	T	11: 117,614,355 (GRCm39)	R838W	probably damaging	Het
Vmn2r29	C	G	7: 7,243,011 (GRCm39)	D500H	probably damaging	Het

Other mutations in Dcdc5

Allele	Source	Chr	Coord	Type	Predicted Effect
R0017:Dcdc5	UTSW	2	106,187,541 (GRCm39)	splice site	noncoding transcript
R0017:Dcdc5	UTSW	2	106,187,541 (GRCm39)	splice site	noncoding transcript
R0544:Dcdc5	UTSW	2	106,181,909 (GRCm39)	exon	noncoding transcript
R0563:Dcdc5	UTSW	2	106,180,035 (GRCm39)	exon	noncoding transcript
R1456:Dcdc5	UTSW	2	106,181,910 (GRCm39)	exon	noncoding transcript
R1476:Dcdc5	UTSW	2	106,188,977 (GRCm39)	exon	noncoding transcript
R1521:Dcdc5	UTSW	2	106,182,014 (GRCm39)	critical splice donor site	noncoding transcript
R1555:Dcdc5	UTSW	2	106,214,480 (GRCm39)	exon	noncoding transcript
R2280:Dcdc5	UTSW	2	106,202,867 (GRCm39)	critical splice donor site	noncoding transcript
R2304:Dcdc5	UTSW	2	106,166,488 (GRCm39)	critical splice donor site	noncoding transcript
R4820:Dcdc5	UTSW	2	106,166,420 (GRCm39)	exon	noncoding transcript
R4874:Dcdc5	UTSW	2	106,198,451 (GRCm39)	exon	noncoding transcript
R4910:Dcdc5	UTSW	2	106,195,895 (GRCm39)	exon	noncoding transcript
R5285:Dcdc5	UTSW	2	106,198,500 (GRCm39)	exon	noncoding transcript
R5583:Dcdc5	UTSW	2	106,195,778 (GRCm39)	exon	noncoding transcript
R5634:Dcdc5	UTSW	2	106,234,325 (GRCm39)	exon	noncoding transcript
R6313:Dcdc5	UTSW	2	106,198,516 (GRCm39)	critical splice donor site	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- GCAACAAGACATAGAAGGTTACCTG -3'
(R):5'- TGAACCATTTACCAAAGTGGCTG -3'

Sequencing Primer
(F):5'- AAGTGCAGTTCATGAATGCCTG -3'
(R):5'- CCAAAGTGGCTGGCTATAATTTTG -3'

Posted On

2015-03-25