Incidental Mutation 'R3854:Nhlrc2'
ID276088
Institutional Source Beutler Lab
Gene Symbol Nhlrc2
Ensembl Gene ENSMUSG00000025078
Gene NameNHL repeat containing 2
Synonyms
MMRRC Submission 041605-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3854 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56548261-56598846 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 56588271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000071370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423]
Predicted Effect probably null
Transcript: ENSMUST00000071423
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 94.2%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr1 T C 2: 58,462,934 K338R probably damaging Het
Adar C T 3: 89,736,258 P482L probably damaging Het
Adh5 A G 3: 138,451,015 D154G probably benign Het
Apoa1 A G 9: 46,230,223 S206G probably benign Het
Aspdh T C 7: 44,466,189 V5A possibly damaging Het
Bend3 AAGGACCA AA 10: 43,510,717 probably benign Het
C2cd3 A T 7: 100,454,601 probably null Het
Ccdc87 A G 19: 4,839,518 I13V probably benign Het
Cd163 A T 6: 124,311,566 N319Y probably damaging Het
Cdc42bpa A G 1: 180,155,978 probably benign Het
Ceacam2 T C 7: 25,538,802 S66G probably benign Het
Cep131 G A 11: 120,067,185 R772* probably null Het
Clhc1 T C 11: 29,571,789 C441R probably damaging Het
Clstn2 G A 9: 97,463,595 Q567* probably null Het
Cops7a C T 6: 124,959,832 R252H probably damaging Het
Daam2 T C 17: 49,458,596 N1093S probably benign Het
Dnajc16 G A 4: 141,763,653 R729* probably null Het
Dscr3 A G 16: 94,510,806 F95L probably benign Het
Eml6 C T 11: 29,749,905 A1744T possibly damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fbll1 T A 11: 35,797,699 T246S probably benign Het
Fbln2 A T 6: 91,266,371 T910S probably damaging Het
Fcna C T 2: 25,627,772 G22D possibly damaging Het
Gadl1 G T 9: 116,006,664 E387* probably null Het
Gm5592 G A 7: 41,157,835 probably benign Het
Gpr82 A T X: 13,665,338 T42S probably benign Het
Hk2 T C 6: 82,736,676 E447G possibly damaging Het
Idi1 G T 13: 8,885,932 A25S probably benign Het
Lbr G A 1: 181,831,715 T167I probably benign Het
Mdh1 C T 11: 21,559,281 V234I probably benign Het
Muc2 A G 7: 141,754,344 H420R probably damaging Het
Nrcam G T 12: 44,575,884 A938S probably benign Het
Nt5c2 A G 19: 46,896,518 V252A probably damaging Het
Olfr406 A T 11: 74,270,279 K297* probably null Het
Olfr419 T A 1: 174,250,150 Y259F probably damaging Het
Olfr550 T G 7: 102,579,020 L175R probably damaging Het
Pgap3 T C 11: 98,390,812 T187A possibly damaging Het
Pus10 T C 11: 23,703,003 probably null Het
Rnf213 T C 11: 119,480,939 probably benign Het
Sag T C 1: 87,824,518 probably benign Het
Serpinb9e A G 13: 33,255,154 I188V probably benign Het
Shcbp1l A T 1: 153,452,444 I634F probably damaging Het
Slc6a16 T A 7: 45,268,172 C485S probably damaging Het
Vmn1r215 A C 13: 23,075,888 M33L probably benign Het
Other mutations in Nhlrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Nhlrc2 APN 19 56551799 nonsense probably null
IGL01524:Nhlrc2 APN 19 56576155 missense probably benign 0.39
IGL01570:Nhlrc2 APN 19 56574787 missense possibly damaging 0.87
IGL01653:Nhlrc2 APN 19 56570850 missense probably benign 0.25
IGL02256:Nhlrc2 APN 19 56597361 missense probably benign 0.10
IGL02303:Nhlrc2 APN 19 56574848 missense probably damaging 1.00
IGL02349:Nhlrc2 APN 19 56591719 missense possibly damaging 0.94
IGL02501:Nhlrc2 APN 19 56570654 nonsense probably null
R0270:Nhlrc2 UTSW 19 56551870 missense probably damaging 1.00
R0454:Nhlrc2 UTSW 19 56570527 missense probably damaging 1.00
R2022:Nhlrc2 UTSW 19 56597278 missense probably benign 0.06
R3855:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R3856:Nhlrc2 UTSW 19 56588271 critical splice donor site probably null
R4659:Nhlrc2 UTSW 19 56576267 missense possibly damaging 0.86
R4767:Nhlrc2 UTSW 19 56570466 missense probably benign 0.03
R4992:Nhlrc2 UTSW 19 56570534 missense probably benign 0.00
R5877:Nhlrc2 UTSW 19 56570584 missense probably damaging 1.00
R6191:Nhlrc2 UTSW 19 56570859 missense probably benign 0.00
R6755:Nhlrc2 UTSW 19 56591784 missense probably benign 0.12
R7164:Nhlrc2 UTSW 19 56592499 missense probably damaging 1.00
R7507:Nhlrc2 UTSW 19 56597378 missense not run
R7609:Nhlrc2 UTSW 19 56594896 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAACCGTGTTCTGAAACAG -3'
(R):5'- TGACTGCAGACACAGGAAC -3'

Sequencing Primer
(F):5'- AAGGTTCAGAGGTCCAAA -3'
(R):5'- GCTTTGAGAACCAGCTAGTGACTC -3'
Posted On2015-04-06