Incidental Mutation 'R3923:Hdgf'
ID307021
Institutional Source Beutler Lab
Gene Symbol Hdgf
Ensembl Gene ENSMUSG00000004897
Gene Namehepatoma-derived growth factor
SynonymsD3Ertd299e
MMRRC Submission 040820-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3923 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location87906321-87916132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87914228 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 128 (D128E)
Ref Sequence ENSEMBL: ENSMUSP00000124803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005017] [ENSMUST00000159492] [ENSMUST00000162631]
Predicted Effect probably benign
Transcript: ENSMUST00000005017
AA Change: D160E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005017
Gene: ENSMUSG00000004897
AA Change: D160E

DomainStartEndE-ValueType
PWWP 10 67 4.54e-26 SMART
low complexity region 109 120 N/A INTRINSIC
low complexity region 212 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159492
AA Change: D128E

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124803
Gene: ENSMUSG00000004897
AA Change: D128E

DomainStartEndE-ValueType
Pfam:PWWP 2 60 1.2e-9 PFAM
low complexity region 77 88 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161616
Predicted Effect probably benign
Transcript: ENSMUST00000162631
SMART Domains Protein: ENSMUSP00000123832
Gene: ENSMUSG00000004897

DomainStartEndE-ValueType
Pfam:PWWP 1 60 2.3e-10 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and fertile and display no major morphological, biochemical or behavioral phenotypes except for a significant reduction in rearing activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 T C 5: 8,130,514 M528V possibly damaging Het
Ano3 T A 2: 110,770,959 Y318F probably damaging Het
Asic4 T A 1: 75,451,227 D132E probably damaging Het
Atp2b2 A G 6: 113,797,108 probably null Het
Cast T C 13: 74,728,413 E447G probably damaging Het
Ccdc110 T C 8: 45,942,389 I439T probably damaging Het
Ccdc129 T C 6: 55,968,060 S589P probably benign Het
Ccdc50 A T 16: 27,444,544 R264S probably damaging Het
Chd9 T A 8: 90,933,519 V369E probably benign Het
Cnnm1 A G 19: 43,440,445 M1V probably null Het
Col4a1 T A 8: 11,201,665 probably benign Het
Crtac1 A G 19: 42,333,947 V118A probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dtd2 G C 12: 52,004,951 probably null Het
Ehmt1 A T 2: 24,884,335 probably null Het
Emc1 T A 4: 139,363,185 L412* probably null Het
Ep400 T C 5: 110,756,523 N70S possibly damaging Het
Ercc6l2 T C 13: 63,870,735 probably benign Het
Fam69c A T 18: 84,730,687 T137S probably damaging Het
Fry T C 5: 150,413,349 V1395A probably benign Het
Gm281 T A 14: 13,865,990 K300* probably null Het
Gps1 A G 11: 120,786,433 N186S possibly damaging Het
Hipk3 A G 2: 104,470,762 S362P probably damaging Het
Hypk C A 2: 121,458,202 H116Q possibly damaging Het
Ifna9 T A 4: 88,592,271 T39S possibly damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kdm5a T C 6: 120,381,664 S223P probably benign Het
Kif21a C T 15: 90,937,294 S1432N possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lrrn2 A G 1: 132,938,492 S432G probably benign Het
Mlana T A 19: 29,704,698 S50R probably damaging Het
Mycbp2 A T 14: 103,126,713 H4383Q probably damaging Het
Ncor1 A G 11: 62,325,616 S1469P probably damaging Het
Nol6 G T 4: 41,121,531 F270L probably benign Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Nrap T C 19: 56,380,256 I243V probably damaging Het
Obscn T C 11: 59,060,928 I4297V possibly damaging Het
Olfr1056 T C 2: 86,355,861 I174V probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Palb2 A T 7: 122,117,360 probably null Het
Plod1 T C 4: 147,915,823 K260E possibly damaging Het
Rgsl1 T C 1: 153,804,130 probably null Het
Rpe65 T A 3: 159,604,400 F103L probably benign Het
Ryr3 C T 2: 112,841,873 A1438T possibly damaging Het
Slc17a3 G A 13: 23,858,054 V402M possibly damaging Het
Slc19a3 A T 1: 83,022,957 F113Y probably damaging Het
Snph C T 2: 151,593,511 C430Y probably damaging Het
Tarbp1 T C 8: 126,440,771 I1101V probably benign Het
Tatdn1 G A 15: 58,921,171 L120F possibly damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Trpv5 T C 6: 41,653,249 T636A probably benign Het
Ube2l6 A G 2: 84,809,074 D127G possibly damaging Het
Usp33 T A 3: 152,374,791 probably null Het
Usp53 A T 3: 122,934,305 F876Y probably benign Het
Utrn A T 10: 12,739,479 I316K probably benign Het
Zfp106 G T 2: 120,534,856 Q357K probably damaging Het
Zfp143 T C 7: 110,074,191 V138A probably damaging Het
Zfp451 T C 1: 33,779,045 R118G probably null Het
Other mutations in Hdgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Hdgf APN 3 87914524 missense possibly damaging 0.93
IGL02437:Hdgf APN 3 87914485 missense probably damaging 1.00
IGL03189:Hdgf APN 3 87913428 missense possibly damaging 0.80
R0142:Hdgf UTSW 3 87913109 missense possibly damaging 0.68
R1604:Hdgf UTSW 3 87914040 splice site probably null
R3726:Hdgf UTSW 3 87914497 missense probably benign 0.19
R4620:Hdgf UTSW 3 87914576 missense possibly damaging 0.81
R4622:Hdgf UTSW 3 87914577 missense possibly damaging 0.53
R7562:Hdgf UTSW 3 87906686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGATGTCTCCACCACAGTCC -3'
(R):5'- CTGACTCCTTGGGACGTTTAGG -3'

Sequencing Primer
(F):5'- GTCCTCCCAGAAAAAGAGTTGTGC -3'
(R):5'- GCTAGAGACAGAACATTAATAGCTC -3'
Posted On2015-04-17