Incidental Mutation 'R3746:Selenom'
ID309818
Institutional Source Beutler Lab
Gene Symbol Selenom
Ensembl Gene ENSMUSG00000075702
Gene Nameselenoprotein M
SynonymsSelm, 1500040L08Rik, SelM
MMRRC Submission 040732-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R3746 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3514684-3517351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3517132 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 137 (E137G)
Ref Sequence ENSEMBL: ENSMUSP00000092041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000094469] [ENSMUST00000110011] [ENSMUST00000170588]
Predicted Effect probably benign
Transcript: ENSMUST00000020718
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020721
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075118
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094469
AA Change: E137G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092041
Gene: ENSMUSG00000075702
AA Change: E137G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sep15_SelM 40 114 3.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110011
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably benign
Transcript: ENSMUST00000170588
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the selenoprotein M/SEP15 family. The exact function of this protein is not known. It is localized in the perinuclear region, is highly expressed in the brain, and may be involved in neurodegenerative disorders. Transgenic mice with targeted deletion of this gene exhibit increased weight gain, suggesting a role for this gene in the regulation of body weight and energy metabolism. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit obesity without cognitive deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,888,654 E347* probably null Het
Abcb5 T C 12: 118,874,620 D1069G probably damaging Het
Ago1 A G 4: 126,461,044 I125T probably benign Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Chd7 G A 4: 8,752,537 V345M probably damaging Het
Cln6 A G 9: 62,847,002 I109V probably benign Het
Csmd3 A T 15: 47,849,766 F1604Y probably benign Het
Cx3cr1 T C 9: 120,052,066 H90R probably damaging Het
Dip2c A T 13: 9,601,473 D674V probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Eif3g G A 9: 20,894,697 R295C probably benign Het
Epha5 T C 5: 84,059,104 K998E probably damaging Het
Fam171b A T 2: 83,879,600 T539S probably damaging Het
Fer1l4 G T 2: 156,035,048 H1159N probably benign Het
Fsip1 A G 2: 118,233,050 C313R probably damaging Het
Gm12800 T A 4: 101,909,876 D107E possibly damaging Het
Gm37240 T G 3: 84,519,612 N168T probably benign Het
Gm7589 T C 9: 59,145,855 noncoding transcript Het
Igkv20-101-2 A T 6: 68,474,958 I66L possibly damaging Het
Irf3 T C 7: 44,998,873 F54S probably damaging Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
Map3k21 A G 8: 125,935,100 K479E probably damaging Het
Mpdz A C 4: 81,363,147 V609G probably damaging Het
Olfr65 T A 7: 103,907,060 M207K probably benign Het
Opcml G A 9: 28,901,530 V173M possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Pcdh17 A T 14: 84,533,037 Y985F probably benign Het
Piezo1 G T 8: 122,492,638 F1084L probably damaging Het
Pkhd1 A G 1: 20,058,300 *4060Q probably null Het
Plekhn1 T C 4: 156,225,594 T88A probably benign Het
Rmdn2 T A 17: 79,670,552 probably null Het
Slc38a7 A G 8: 95,843,752 probably benign Het
Slc39a12 T C 2: 14,396,067 probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Tmem63a G A 1: 180,963,114 D446N possibly damaging Het
Trim63 G A 4: 134,315,354 C44Y probably damaging Het
Ush2a G A 1: 188,810,292 G3352S probably benign Het
Vmn1r4 A G 6: 56,957,131 R207G probably damaging Het
Vmn2r76 A G 7: 86,225,555 V738A probably benign Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Other mutations in Selenom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03018:Selenom APN 11 3516508 missense probably damaging 1.00
R5831:Selenom UTSW 11 3516882 nonsense probably null
R6216:Selenom UTSW 11 3514915 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTGGCTAAGTGCTGATCCC -3'
(R):5'- ATAAGAAGAGACTCCGCGTG -3'

Sequencing Primer
(F):5'- TAAGTGCTGATCCCGCCCTTTC -3'
(R):5'- AGGGAGGATTGAGATTCCCCC -3'
Posted On2015-04-17