Incidental Mutation 'R3959:Serpina3f'
ID310849
Institutional Source Beutler Lab
Gene Symbol Serpina3f
Ensembl Gene ENSMUSG00000066363
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms2A1, alpha-1 antiproteinasin, antitrypsin
MMRRC Submission 040835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R3959 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104214544-104221129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104217140 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 87 (I87N)
Ref Sequence ENSEMBL: ENSMUSP00000126520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101080] [ENSMUST00000121337] [ENSMUST00000167049]
Predicted Effect probably damaging
Transcript: ENSMUST00000101080
AA Change: I87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098641
Gene: ENSMUSG00000066363
AA Change: I87N

DomainStartEndE-ValueType
SERPIN 46 408 1.58e-186 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121337
AA Change: I87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113945
Gene: ENSMUSG00000066363
AA Change: I87N

DomainStartEndE-ValueType
SERPIN 46 408 1.58e-186 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167049
AA Change: I87N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126520
Gene: ENSMUSG00000066363
AA Change: I87N

DomainStartEndE-ValueType
SERPIN 46 408 1.58e-186 SMART
Meta Mutation Damage Score 0.7616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Adam26a T C 8: 43,569,871 H194R probably benign Het
Ccdc129 A T 6: 55,897,740 Q225L probably benign Het
Celf4 A G 18: 25,537,754 M124T probably benign Het
Csmd3 A T 15: 47,644,189 I2976K probably benign Het
Dnhd1 A G 7: 105,713,122 H3730R probably benign Het
Dock8 G A 19: 25,184,941 probably null Het
Eed C T 7: 89,954,941 R441Q probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etl4 A G 2: 20,340,043 T53A probably benign Het
Evc2 T A 5: 37,415,776 V944E possibly damaging Het
Hmgcs2 T C 3: 98,297,477 F317S possibly damaging Het
Itpr2 C T 6: 146,425,510 V120I probably damaging Het
Mapk8 A C 14: 33,382,253 M402R probably null Het
Mycbp2 T C 14: 103,295,252 Y389C probably benign Het
Nceh1 T C 3: 27,279,196 I147T probably benign Het
Nfatc3 C T 8: 106,099,077 R587* probably null Het
Nin A T 12: 70,050,752 F516L probably damaging Het
Npm1 T A 11: 33,154,012 N272Y probably damaging Het
Ntrk3 T C 7: 78,198,842 E787G probably damaging Het
Olfr1093 G A 2: 86,785,996 V89I probably benign Het
Ppp1r21 A G 17: 88,549,816 E189G probably damaging Het
Prrc2c A T 1: 162,708,892 probably benign Het
Rrn3 T C 16: 13,782,100 probably null Het
Sec23ip C G 7: 128,776,850 T796S probably benign Het
Slc22a27 G A 19: 7,910,049 T188I probably damaging Het
Triobp T A 15: 79,002,389 C1930* probably null Het
Ucp3 A G 7: 100,482,739 T266A probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r2 C T 3: 64,140,526 M6I probably benign Het
Vmn2r72 A T 7: 85,751,131 L237I probably benign Het
Zfp518a A C 19: 40,912,698 Q357P probably damaging Het
Other mutations in Serpina3f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Serpina3f APN 12 104217340 missense probably benign 0.44
IGL01375:Serpina3f APN 12 104220476 missense unknown
IGL01575:Serpina3f APN 12 104218440 missense probably damaging 1.00
IGL01712:Serpina3f APN 12 104218398 missense probably damaging 1.00
IGL02001:Serpina3f APN 12 104219466 missense probably damaging 1.00
IGL02882:Serpina3f APN 12 104217004 missense probably damaging 1.00
IGL03145:Serpina3f APN 12 104217457 missense probably benign 0.06
R0158:Serpina3f UTSW 12 104217008 missense probably damaging 1.00
R0739:Serpina3f UTSW 12 104218353 missense probably damaging 1.00
R1667:Serpina3f UTSW 12 104217440 missense probably damaging 1.00
R1800:Serpina3f UTSW 12 104217406 missense probably damaging 1.00
R2010:Serpina3f UTSW 12 104217323 missense probably damaging 1.00
R2356:Serpina3f UTSW 12 104217367 nonsense probably null
R3926:Serpina3f UTSW 12 104219481 missense possibly damaging 0.58
R4619:Serpina3f UTSW 12 104217290 missense possibly damaging 0.93
R4765:Serpina3f UTSW 12 104219431 missense probably benign 0.03
R4977:Serpina3f UTSW 12 104217055 missense probably benign 0.00
R4994:Serpina3f UTSW 12 104220356 missense probably benign 0.04
R5432:Serpina3f UTSW 12 104220318 missense possibly damaging 0.79
R5733:Serpina3f UTSW 12 104216923 missense possibly damaging 0.63
R7670:Serpina3f UTSW 12 104217266 missense probably damaging 1.00
R7727:Serpina3f UTSW 12 104218218 missense probably benign 0.37
R7754:Serpina3f UTSW 12 104217306 missense possibly damaging 0.69
X0028:Serpina3f UTSW 12 104217271 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCACATCAGTGGACAGTTTAACAC -3'
(R):5'- AGAGGCTGCTGGAAATCTGC -3'

Sequencing Primer
(F):5'- CTGGCCTCCAGCAACACTG -3'
(R):5'- AAATCTGCTGTGAAGGCCTC -3'
Posted On2015-04-29