Mutagenetix > Incidental Mutation

Incidental Mutation 'R3969:Ncstn'

310864

Institutional Source

Beutler Lab

Gene Symbol

Ncstn

Ensembl Gene

ENSMUSG00000003458

Gene Name

nicastrin

Synonyms

Nct, nicastrin, D1Dau13e, 9430068N19Rik

MMRRC Submission

040937-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3969 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

172066013-172082795 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 172070009 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 439 (V439G)

Ref Sequence

ENSEMBL: ENSMUSP00000003550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]

AlphaFold

P57716

Predicted Effect

probably damaging
Transcript: ENSMUST00000003550
AA Change: V439G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: V439G

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Peptidase_M28	254	468	2.9e-7	PFAM
Pfam:Nicastrin	273	498	1.6e-94	PFAM
transmembrane domain	669	691	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135928

Predicted Effect

probably benign
Transcript: ENSMUST00000140643

SMART Domains

Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146137

SMART Domains

Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Meta Mutation Damage Score

0.9442

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahi1	A	G	10: 20,959,947	K60E	probably damaging	Het
Arhgef12	C	A	9: 43,005,551	R432L	probably damaging	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Camk2d	G	T	3: 126,796,959	C273F	possibly damaging	Het
Camk4	T	A	18: 33,179,581	I258N	possibly damaging	Het
Chia1	T	G	3: 106,121,635		probably null	Het
Commd9	C	A	2: 101,897,141	N93K	probably benign	Het
Cpeb4	T	C	11: 31,872,811	I175T	possibly damaging	Het
Dnah17	G	A	11: 118,041,158		probably benign	Het
E2f1	C	G	2: 154,564,022	G144R	probably damaging	Het
Faap100	A	T	11: 120,378,705	M1K	probably null	Het
Fam196b	A	T	11: 34,419,739	Q481L	probably damaging	Het
Flna	A	T	X: 74,235,667	V1253E	probably damaging	Het
Fryl	A	T	5: 73,112,423	S396R	probably damaging	Het
Gm12185	A	T	11: 48,907,345	C774S	probably benign	Het
Habp2	A	G	19: 56,311,701	Y194C	probably damaging	Het
Irf5	A	T	6: 29,536,782	Q497H	probably benign	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Lins1	C	T	7: 66,708,198	T27I	probably benign	Het
Nlrx1	A	T	9: 44,255,425		probably benign	Het
Nol8	A	T	13: 49,660,016	K162*	probably null	Het
Olfr836	A	G	9: 19,121,660	E232G	probably benign	Het
Olfr921	A	G	9: 38,775,368	T38A	probably benign	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pecr	G	A	1: 72,276,309	T94I	probably damaging	Het
Piezo2	A	T	18: 63,011,696	V2776E	probably damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Pole3	G	T	4: 62,524,961	N12K	possibly damaging	Het
Prl2a1	A	G	13: 27,806,280	S71G	probably benign	Het
Rab39	G	A	9: 53,686,632	A111V	possibly damaging	Het
Rb1cc1	T	A	1: 6,248,270		probably benign	Het
Shroom3	T	C	5: 92,940,879	V496A	probably benign	Het
Slc26a1	A	G	5: 108,673,952	S24P	probably benign	Het
Tspoap1	A	T	11: 87,762,446	N113Y	probably damaging	Het
Usp17lc	A	T	7: 103,418,419	H307L	probably damaging	Het
Vmn2r79	T	C	7: 87,003,593	W498R	probably damaging	Het
Vmn2r94	C	A	17: 18,258,385	Q33H	possibly damaging	Het
Wwc2	T	C	8: 47,856,323	D808G	unknown	Het
Ybx2	G	A	11: 69,940,416	R84Q	probably damaging	Het
Zfp462	C	T	4: 55,012,402	S308F	probably damaging	Het

Other mutations in Ncstn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Ncstn	APN	1	172074401	missense	probably benign	0.02
IGL02030:Ncstn	APN	1	172072457	splice site	probably benign
IGL02470:Ncstn	APN	1	172082599	critical splice donor site	probably null
IGL02498:Ncstn	APN	1	172068592	missense	probably benign
morel	UTSW	1	172072476	missense	probably damaging	0.99
Pig	UTSW	1	172071525	missense	probably damaging	1.00
truffle	UTSW	1	172070009	missense	probably damaging	1.00
R0048:Ncstn	UTSW	1	172069961	splice site	probably benign
R0480:Ncstn	UTSW	1	172082592	splice site	probably benign
R0648:Ncstn	UTSW	1	172067887	missense	probably benign	0.01
R0792:Ncstn	UTSW	1	172071505	missense	possibly damaging	0.95
R1330:Ncstn	UTSW	1	172071525	missense	probably damaging	1.00
R1524:Ncstn	UTSW	1	172072149	missense	possibly damaging	0.58
R1660:Ncstn	UTSW	1	172066772	missense	possibly damaging	0.78
R1828:Ncstn	UTSW	1	172071471	frame shift	probably null
R1892:Ncstn	UTSW	1	172071471	frame shift	probably null
R1907:Ncstn	UTSW	1	172072143	missense	probably damaging	0.97
R3722:Ncstn	UTSW	1	172067895	missense	possibly damaging	0.50
R3876:Ncstn	UTSW	1	172070073	missense	probably benign	0.02
R3946:Ncstn	UTSW	1	172067494	missense	probably benign	0.00
R4108:Ncstn	UTSW	1	172072544	missense	probably damaging	1.00
R4597:Ncstn	UTSW	1	172068256	nonsense	probably null
R4998:Ncstn	UTSW	1	172071520	missense	possibly damaging	0.81
R5037:Ncstn	UTSW	1	172068626	missense	probably damaging	1.00
R5150:Ncstn	UTSW	1	172067584	intron	probably benign
R5406:Ncstn	UTSW	1	172072164	missense	probably benign	0.00
R5444:Ncstn	UTSW	1	172072839	missense	possibly damaging	0.92
R5605:Ncstn	UTSW	1	172081150	intron	probably benign
R6675:Ncstn	UTSW	1	172071528	missense	probably damaging	1.00
R7268:Ncstn	UTSW	1	172081263	missense	possibly damaging	0.86
R7290:Ncstn	UTSW	1	172072806	missense	probably benign
R7871:Ncstn	UTSW	1	172075456	missense	probably benign	0.00
R8238:Ncstn	UTSW	1	172072476	missense	probably damaging	0.99
R9462:Ncstn	UTSW	1	172072140	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATCGGCTATTACAGGAAGAATCC -3'
(R):5'- TTGAAGACTGTCTAGGAGAGCG -3'

Sequencing Primer
(F):5'- AGAATCCAAACTTCCTGGGAG -3'
(R):5'- TACTGAGAGCCCTCCTGC -3'

Posted On

2015-04-29