Incidental Mutation 'R5037:Ncstn'
ID389557
Institutional Source Beutler Lab
Gene Symbol Ncstn
Ensembl Gene ENSMUSG00000003458
Gene Namenicastrin
SynonymsNct, nicastrin, D1Dau13e, 9430068N19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172066013-172082795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172068626 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 495 (R495H)
Ref Sequence ENSEMBL: ENSMUSP00000003550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]
Predicted Effect probably damaging
Transcript: ENSMUST00000003550
AA Change: R495H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: R495H

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Peptidase_M28 254 468 2.9e-7 PFAM
Pfam:Nicastrin 273 498 1.6e-94 PFAM
transmembrane domain 669 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135928
Predicted Effect probably benign
Transcript: ENSMUST00000140643
SMART Domains Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146137
SMART Domains Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Mthfd1 T G 12: 76,294,140 F258V probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Ncstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Ncstn APN 1 172074401 missense probably benign 0.02
IGL02030:Ncstn APN 1 172072457 splice site probably benign
IGL02470:Ncstn APN 1 172082599 critical splice donor site probably null
IGL02498:Ncstn APN 1 172068592 missense probably benign
Pig UTSW 1 172071525 missense probably damaging 1.00
truffle UTSW 1 172070009 missense probably damaging 1.00
R0048:Ncstn UTSW 1 172069961 splice site probably benign
R0480:Ncstn UTSW 1 172082592 splice site probably benign
R0648:Ncstn UTSW 1 172067887 missense probably benign 0.01
R0792:Ncstn UTSW 1 172071505 missense possibly damaging 0.95
R1330:Ncstn UTSW 1 172071525 missense probably damaging 1.00
R1524:Ncstn UTSW 1 172072149 missense possibly damaging 0.58
R1660:Ncstn UTSW 1 172066772 missense possibly damaging 0.78
R1828:Ncstn UTSW 1 172071471 frame shift probably null
R1892:Ncstn UTSW 1 172071471 frame shift probably null
R1907:Ncstn UTSW 1 172072143 missense probably damaging 0.97
R3722:Ncstn UTSW 1 172067895 missense possibly damaging 0.50
R3876:Ncstn UTSW 1 172070073 missense probably benign 0.02
R3946:Ncstn UTSW 1 172067494 missense probably benign 0.00
R3969:Ncstn UTSW 1 172070009 missense probably damaging 1.00
R4108:Ncstn UTSW 1 172072544 missense probably damaging 1.00
R4597:Ncstn UTSW 1 172068256 nonsense probably null
R4998:Ncstn UTSW 1 172071520 missense possibly damaging 0.81
R5150:Ncstn UTSW 1 172067584 intron probably benign
R5406:Ncstn UTSW 1 172072164 missense probably benign 0.00
R5444:Ncstn UTSW 1 172072839 missense possibly damaging 0.92
R5605:Ncstn UTSW 1 172081150 intron probably benign
R6675:Ncstn UTSW 1 172071528 missense probably damaging 1.00
R7268:Ncstn UTSW 1 172081263 missense possibly damaging 0.86
R7290:Ncstn UTSW 1 172072806 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGGCATGCTAAATCCCAAAG -3'
(R):5'- ACCAGAGCATTTATGACACGG -3'

Sequencing Primer
(F):5'- CAAAGTTTGGGAAGTTGGCAC -3'
(R):5'- CATTAATGTGACCTATCCTGAGTGGC -3'
Posted On2016-06-06