Incidental Mutation 'R4039:4933412E24Rik'
ID313862
Institutional Source Beutler Lab
Gene Symbol 4933412E24Rik
Ensembl Gene ENSMUSG00000071749
Gene NameRIKEN cDNA 4933412E24 gene
Synonyms
MMRRC Submission 041614-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4039 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location60014866-60016613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60016366 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 75 (L75Q)
Ref Sequence ENSEMBL: ENSMUSP00000094154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096421
AA Change: L75Q

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094154
Gene: ENSMUSG00000071749
AA Change: L75Q

DomainStartEndE-ValueType
Pfam:DUF4641 79 509 5.4e-189 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cep290 T C 10: 100,512,401 probably null Het
Col11a2 A G 17: 34,045,774 T268A probably benign Het
Crnkl1 T A 2: 145,932,327 D72V possibly damaging Het
Csn2 C T 5: 87,698,076 M1I probably null Het
Dhcr24 T C 4: 106,573,878 F255L probably benign Het
Epn2 A G 11: 61,546,522 Y75H probably damaging Het
Galnt3 A T 2: 66,085,327 H563Q probably damaging Het
Galnt9 T C 5: 110,614,208 V37A probably damaging Het
Glb1l3 A C 9: 26,829,047 M329R probably damaging Het
Gorab A T 1: 163,397,066 D55E possibly damaging Het
Herc2 G A 7: 56,156,411 R2318Q probably damaging Het
Hspa2 T C 12: 76,405,768 V412A probably damaging Het
Hspb8 A G 5: 116,409,344 V193A probably benign Het
Ly75 A G 2: 60,352,995 L481P probably damaging Het
Lyzl1 T C 18: 4,169,140 L48P probably damaging Het
Mettl27 C T 5: 134,940,609 Q212* probably null Het
Mmachc T A 4: 116,706,018 T47S probably damaging Het
Ncam2 C T 16: 81,490,323 S375L probably benign Het
Ogfrl1 T C 1: 23,378,964 probably benign Het
Parp9 T C 16: 35,960,047 L461P probably damaging Het
Pcsk7 A G 9: 45,928,007 probably null Het
Plekhh1 C A 12: 79,055,183 H342Q probably benign Het
Prdm13 T G 4: 21,685,774 probably benign Het
Prkaa2 T C 4: 105,051,247 N144D probably damaging Het
Ptpn12 A T 5: 21,002,510 Y283* probably null Het
Rab12 T C 17: 66,500,401 Y111C possibly damaging Het
Ralgapa1 T C 12: 55,795,701 N61S probably damaging Het
Rims1 T C 1: 22,475,712 S537G probably damaging Het
Sash1 G T 10: 8,729,627 P1000T probably damaging Het
Skint5 G T 4: 113,885,814 T352K unknown Het
Slc12a5 A G 2: 164,992,330 E757G probably benign Het
Sycp2 C A 2: 178,380,927 M470I possibly damaging Het
Szt2 T C 4: 118,364,952 probably benign Het
Tbc1d1 A G 5: 64,316,428 T765A probably damaging Het
Tgfbr2 T C 9: 116,175,037 M1V probably null Het
Tnfrsf11a A G 1: 105,827,739 probably null Het
Trim43b A G 9: 89,091,347 L111P probably damaging Het
Ttbk2 A T 2: 120,745,795 S900R probably benign Het
Unc79 G A 12: 103,074,949 C747Y possibly damaging Het
Vmn1r218 T C 13: 23,136,801 V26A possibly damaging Het
Vmn2r115 A T 17: 23,345,103 Y83F probably benign Het
Zfp536 A T 7: 37,569,550 L147Q probably damaging Het
Zfp931 T A 2: 178,067,984 Q203L possibly damaging Het
Zswim2 G A 2: 83,915,994 H367Y probably damaging Het
Other mutations in 4933412E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:4933412E24Rik APN 15 60015575 missense possibly damaging 0.82
IGL02078:4933412E24Rik APN 15 60016330 missense probably benign 0.02
IGL02493:4933412E24Rik APN 15 60016463 missense probably benign 0.00
IGL03336:4933412E24Rik APN 15 60016402 missense probably benign 0.00
R0466:4933412E24Rik UTSW 15 60015472 missense probably benign 0.00
R0961:4933412E24Rik UTSW 15 60015311 missense probably benign 0.36
R1765:4933412E24Rik UTSW 15 60015345 nonsense probably null
R2341:4933412E24Rik UTSW 15 60016363 missense possibly damaging 0.85
R2440:4933412E24Rik UTSW 15 60016280 missense probably benign
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R4416:4933412E24Rik UTSW 15 60016423 missense possibly damaging 0.88
R4868:4933412E24Rik UTSW 15 60015968 missense possibly damaging 0.50
R4907:4933412E24Rik UTSW 15 60016108 missense probably benign 0.00
R5462:4933412E24Rik UTSW 15 60015068 missense probably benign 0.09
R7275:4933412E24Rik UTSW 15 60015889 missense probably benign 0.32
R7842:4933412E24Rik UTSW 15 60016573 missense probably damaging 1.00
R7925:4933412E24Rik UTSW 15 60016573 missense probably damaging 1.00
R8261:4933412E24Rik UTSW 15 60016576 missense probably benign 0.44
R8297:4933412E24Rik UTSW 15 60015675 missense probably damaging 1.00
X0052:4933412E24Rik UTSW 15 60016526 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTGCCTCCTCGGAAGCTTG -3'
(R):5'- TTTATGAGGAGAGTGGAGACCTC -3'

Sequencing Primer
(F):5'- TGATGGAGCCTGCCTCTGTC -3'
(R):5'- AGACCTCAACACGGGCTTGAG -3'
Posted On2015-04-30