Incidental Mutation 'R4159:Slc15a5'
ID315657
Institutional Source Beutler Lab
Gene Symbol Slc15a5
Ensembl Gene ENSMUSG00000044378
Gene Namesolute carrier family 15, member 5
Synonyms
MMRRC Submission 041002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4159 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location137983586-138079916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138072940 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 159 (T159K)
Ref Sequence ENSEMBL: ENSMUSP00000129239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171804]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050132
SMART Domains Protein: ENSMUSP00000050794
Gene: ENSMUSG00000044378

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
Pfam:PTR2 167 345 1.2e-8 PFAM
transmembrane domain 375 394 N/A INTRINSIC
low complexity region 417 424 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171804
AA Change: T159K

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129239
Gene: ENSMUSG00000044378
AA Change: T159K

DomainStartEndE-ValueType
Pfam:PTR2 101 485 4.3e-23 PFAM
low complexity region 536 543 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,049 T593I probably benign Het
4932438A13Rik T A 3: 36,931,083 M854K probably benign Het
Adam4 T G 12: 81,420,032 D605A probably damaging Het
Adcy1 A G 11: 7,063,889 H97R probably damaging Het
Amdhd1 A G 10: 93,534,650 Y109H probably damaging Het
Ankhd1 A G 18: 36,589,540 N372S possibly damaging Het
Aoc2 G A 11: 101,325,296 M68I probably damaging Het
Aspscr1 G A 11: 120,708,676 A377T probably damaging Het
Cacnb1 G C 11: 98,012,274 C154W probably damaging Het
Ccdc186 G A 19: 56,793,492 R27* probably null Het
Clnk C A 5: 38,741,795 probably benign Het
Dse A G 10: 34,153,334 F587L probably damaging Het
Fut8 T C 12: 77,393,749 L170P probably damaging Het
G3bp2 T C 5: 92,064,401 H217R probably benign Het
Gm19345 G A 7: 19,854,961 probably benign Het
Hjurp G C 1: 88,277,215 probably benign Het
Kcne4 A G 1: 78,818,102 N156D probably benign Het
Met G T 6: 17,562,272 probably null Het
Mfsd3 T C 15: 76,701,745 L26P probably damaging Het
Oasl1 A G 5: 114,937,014 K378E possibly damaging Het
Pde8a A G 7: 81,320,659 I510V probably benign Het
Pds5a T C 5: 65,664,496 T120A possibly damaging Het
Phkb T A 8: 86,021,533 probably null Het
Ptprz1 A T 6: 23,001,684 K1258* probably null Het
Senp7 C A 16: 56,153,469 P351Q possibly damaging Het
Slc39a6 A G 18: 24,597,828 V362A possibly damaging Het
Spef2 A T 15: 9,676,321 D721E probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmem173 A T 18: 35,739,219 Y77N probably damaging Het
Tnxb A G 17: 34,711,517 T2059A probably damaging Het
Ttll8 T C 15: 88,917,241 N415D probably benign Het
Ube2d2a A T 18: 35,770,524 probably benign Het
Uhrf1bp1 A G 17: 27,884,087 Y365C probably damaging Het
Unc79 A G 12: 103,070,253 probably benign Het
Ush2a G A 1: 188,728,710 V2723M probably damaging Het
Vmn2r102 T A 17: 19,677,826 C368S probably damaging Het
Vmn2r3 G A 3: 64,287,429 Q23* probably null Het
Other mutations in Slc15a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Slc15a5 APN 6 138043538 missense probably damaging 1.00
IGL02090:Slc15a5 APN 6 138043600 missense probably benign 0.00
R0288:Slc15a5 UTSW 6 138017916 splice site probably benign
R0355:Slc15a5 UTSW 6 138018114 splice site probably benign
R0825:Slc15a5 UTSW 6 138018089 missense possibly damaging 0.84
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1721:Slc15a5 UTSW 6 138072847 splice site probably benign
R1897:Slc15a5 UTSW 6 138079764 missense possibly damaging 0.93
R4415:Slc15a5 UTSW 6 138079756 missense probably benign 0.34
R4703:Slc15a5 UTSW 6 138055645 missense probably benign 0.08
R4951:Slc15a5 UTSW 6 138073066 missense probably damaging 1.00
R4996:Slc15a5 UTSW 6 138043585 missense probably damaging 1.00
R5268:Slc15a5 UTSW 6 138079753 missense probably damaging 1.00
R5310:Slc15a5 UTSW 6 138073036 missense probably benign 0.28
R5321:Slc15a5 UTSW 6 137987438 missense probably benign 0.08
R5963:Slc15a5 UTSW 6 138079693 missense probably damaging 1.00
R5988:Slc15a5 UTSW 6 138043531 missense probably benign 0.07
R7400:Slc15a5 UTSW 6 138073057 missense probably benign 0.01
R7515:Slc15a5 UTSW 6 138043498 missense possibly damaging 0.89
R7604:Slc15a5 UTSW 6 138079786 missense probably damaging 1.00
R7707:Slc15a5 UTSW 6 138079747 missense probably damaging 1.00
R8344:Slc15a5 UTSW 6 138079900 missense probably damaging 1.00
R8410:Slc15a5 UTSW 6 138012155 missense
Z1188:Slc15a5 UTSW 6 138017958 missense
Predicted Primers PCR Primer
(F):5'- GACTGACCCATCATCACAGATGTC -3'
(R):5'- GTCTACATCTGTGCTGCAAGC -3'

Sequencing Primer
(F):5'- GATGTCACCACACTGCCACTG -3'
(R):5'- GCTGCAAGCAGTCTCCTTTTC -3'
Posted On2015-05-14