Incidental Mutation 'R0825:Slc15a5'
ID78179
Institutional Source Beutler Lab
Gene Symbol Slc15a5
Ensembl Gene ENSMUSG00000044378
Gene Namesolute carrier family 15, member 5
Synonyms
MMRRC Submission 039005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R0825 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location137983586-138079916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138018089 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 386 (C386Y)
Ref Sequence ENSEMBL: ENSMUSP00000129239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171804]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050132
SMART Domains Protein: ENSMUSP00000050794
Gene: ENSMUSG00000044378

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
Pfam:PTR2 167 345 1.2e-8 PFAM
transmembrane domain 375 394 N/A INTRINSIC
low complexity region 417 424 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111873
AA Change: C78Y
SMART Domains Protein: ENSMUSP00000107504
Gene: ENSMUSG00000044378
AA Change: C78Y

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 167 189 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150278
AA Change: C8Y
Predicted Effect possibly damaging
Transcript: ENSMUST00000171804
AA Change: C386Y

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129239
Gene: ENSMUSG00000044378
AA Change: C386Y

DomainStartEndE-ValueType
Pfam:PTR2 101 485 4.3e-23 PFAM
low complexity region 536 543 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.4%
  • 20x: 91.4%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,400,577 I963N probably damaging Het
AF529169 G A 9: 89,603,279 Q22* probably null Het
Aox4 A G 1: 58,248,909 D727G possibly damaging Het
Arhgef26 T A 3: 62,426,593 I590N probably damaging Het
Arid1b T G 17: 5,342,178 C1994W probably damaging Het
Chd9 T C 8: 91,051,197 I2628T probably benign Het
Clspn G A 4: 126,573,130 probably benign Het
Cyp2a4 A T 7: 26,312,916 T375S probably benign Het
Dmtf1 A T 5: 9,130,388 M226K probably damaging Het
Erap1 T C 13: 74,674,614 probably benign Het
Frmpd1 A G 4: 45,285,394 D1405G possibly damaging Het
Gfm2 A T 13: 97,143,104 probably benign Het
Ghsr T C 3: 27,374,627 V267A probably damaging Het
Golga2 A C 2: 32,304,791 Q650P probably damaging Het
Hmgcl A G 4: 135,960,070 T219A probably benign Het
Ift27 C A 15: 78,165,136 probably benign Het
Igfn1 C T 1: 135,963,126 E2379K probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kpnb1 A T 11: 97,171,675 S421R probably damaging Het
Mtx3 C A 13: 92,850,341 T264K probably damaging Het
Nrg3 G A 14: 39,472,391 P137L possibly damaging Het
Nt5c2 A G 19: 46,898,905 probably benign Het
Olfr1391 T A 11: 49,327,682 H90Q probably benign Het
Olfr199 G T 16: 59,216,450 H54Q possibly damaging Het
Pcdhb2 G A 18: 37,295,657 V228I possibly damaging Het
Pdcd5 G A 7: 35,646,913 R91W possibly damaging Het
Pxdn G A 12: 29,984,996 probably benign Het
Rgl2 T A 17: 33,935,159 probably null Het
Rnf217 T C 10: 31,517,457 D376G probably damaging Het
Sept9 C T 11: 117,359,460 L519F probably damaging Het
Srrm4 T A 5: 116,453,713 I256F unknown Het
Stab1 G T 14: 31,152,600 D950E probably benign Het
Stim2 A G 5: 54,118,483 T667A probably benign Het
Strbp A T 2: 37,635,527 N144K probably benign Het
Sync A G 4: 129,293,397 Y74C probably benign Het
Terb1 A T 8: 104,468,748 M587K possibly damaging Het
Tgfbi T C 13: 56,638,710 probably benign Het
Tmf1 A T 6: 97,175,995 N372K probably benign Het
Ubr4 G T 4: 139,479,576 probably null Het
Uggt1 A T 1: 36,158,143 N1226K probably benign Het
Ugt2b34 T C 5: 86,906,701 I74V possibly damaging Het
Wdfy3 A G 5: 101,870,051 L2541P probably damaging Het
Zfhx3 T G 8: 108,949,208 F2297V probably damaging Het
Other mutations in Slc15a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Slc15a5 APN 6 138043538 missense probably damaging 1.00
IGL02090:Slc15a5 APN 6 138043600 missense probably benign 0.00
R0288:Slc15a5 UTSW 6 138017916 splice site probably benign
R0355:Slc15a5 UTSW 6 138018114 splice site probably benign
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1470:Slc15a5 UTSW 6 138072994 missense probably benign 0.01
R1721:Slc15a5 UTSW 6 138072847 splice site probably benign
R1897:Slc15a5 UTSW 6 138079764 missense possibly damaging 0.93
R4159:Slc15a5 UTSW 6 138072940 missense possibly damaging 0.84
R4415:Slc15a5 UTSW 6 138079756 missense probably benign 0.34
R4703:Slc15a5 UTSW 6 138055645 missense probably benign 0.08
R4951:Slc15a5 UTSW 6 138073066 missense probably damaging 1.00
R4996:Slc15a5 UTSW 6 138043585 missense probably damaging 1.00
R5268:Slc15a5 UTSW 6 138079753 missense probably damaging 1.00
R5310:Slc15a5 UTSW 6 138073036 missense probably benign 0.28
R5321:Slc15a5 UTSW 6 137987438 missense probably benign 0.08
R5963:Slc15a5 UTSW 6 138079693 missense probably damaging 1.00
R5988:Slc15a5 UTSW 6 138043531 missense probably benign 0.07
R7400:Slc15a5 UTSW 6 138073057 missense probably benign 0.01
R7515:Slc15a5 UTSW 6 138043498 missense possibly damaging 0.89
R7604:Slc15a5 UTSW 6 138079786 missense probably damaging 1.00
R7707:Slc15a5 UTSW 6 138079747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTCAGATACTCCAAGCAGCAC -3'
(R):5'- GCCAGCATGGGATACAGTACGAAAC -3'

Sequencing Primer
(F):5'- GCAGCACATACTGTGGAAC -3'
(R):5'- aataGTGGGAAGTTACTTTTAACTCG -3'
Posted On2013-10-16