Incidental Mutation 'R4213:Zswim1'
ID319292
Institutional Source Beutler Lab
Gene Symbol Zswim1
Ensembl Gene ENSMUSG00000017764
Gene Namezinc finger SWIM-type containing 1
Synonyms
MMRRC Submission 041040-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4213 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164822686-164826871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164825785 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 319 (V319A)
Ref Sequence ENSEMBL: ENSMUSP00000017908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017908] [ENSMUST00000017911] [ENSMUST00000042775] [ENSMUST00000052107] [ENSMUST00000132282]
Predicted Effect probably benign
Transcript: ENSMUST00000017908
AA Change: V319A

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000017908
Gene: ENSMUSG00000017764
AA Change: V319A

DomainStartEndE-ValueType
Pfam:SWIM 342 375 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000017911
SMART Domains Protein: ENSMUSP00000017911
Gene: ENSMUSG00000017767

DomainStartEndE-ValueType
Pfam:SPATA25 1 226 3.2e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042775
SMART Domains Protein: ENSMUSP00000041806
Gene: ENSMUSG00000039873

DomainStartEndE-ValueType
Pfam:Neuralized 25 90 1.1e-27 PFAM
SOCS_box 248 285 3.77e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052107
SMART Domains Protein: ENSMUSP00000050970
Gene: ENSMUSG00000045822

DomainStartEndE-ValueType
low complexity region 436 453 N/A INTRINSIC
low complexity region 474 489 N/A INTRINSIC
ZnF_PMZ 546 573 2.09e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141411
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik G A 3: 92,869,127 P83L probably benign Het
Ankrd11 A C 8: 122,891,026 V2029G probably benign Het
Arhgap28 A T 17: 67,871,993 V291E probably benign Het
Cad G A 5: 31,072,344 V1390I probably benign Het
Cadps2 A T 6: 23,599,463 D281E probably damaging Het
Celsr1 G A 15: 86,031,807 T655I probably damaging Het
Cep350 C G 1: 155,935,961 G411A probably damaging Het
Chml A T 1: 175,686,695 F210L probably damaging Het
Col4a4 A T 1: 82,453,144 M1679K unknown Het
Depdc1b T G 13: 108,388,691 F527V probably damaging Het
Dsg2 T C 18: 20,598,514 L731P probably benign Het
Fam69b C T 2: 26,635,948 T298I probably benign Het
Fbxo25 A G 8: 13,939,581 T343A probably damaging Het
Gk5 T C 9: 96,129,053 L72P probably damaging Het
Gm15448 C A 7: 3,821,554 A510S probably damaging Het
Gm648 C T X: 56,545,208 V78I probably benign Het
Gpr137c G A 14: 45,246,508 E231K probably damaging Het
Hdc C T 2: 126,597,866 probably null Het
Hydin A G 8: 110,456,507 N1112S possibly damaging Het
Itgae A G 11: 73,119,352 H556R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krtap17-1 A G 11: 99,993,914 L9P unknown Het
Nmur1 T G 1: 86,387,784 T87P probably damaging Het
Olfr1155 T C 2: 87,943,121 Y169C probably benign Het
Ppp2r5e A G 12: 75,469,551 I244T probably damaging Het
Robo3 C T 9: 37,421,898 G781D probably damaging Het
Siglec1 C T 2: 131,074,118 E1275K probably damaging Het
Slc2a12 A T 10: 22,702,094 K596N probably benign Het
Sorcs1 G A 19: 50,225,175 R705C probably damaging Het
Sqor G T 2: 122,787,498 G92V probably damaging Het
Tlr4 T A 4: 66,840,326 I452N probably damaging Het
Tob1 A G 11: 94,214,192 T185A probably damaging Het
Yjefn3 G T 8: 69,890,890 H50Q probably benign Het
Other mutations in Zswim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Zswim1 UTSW 2 164826126 missense probably damaging 0.99
R0321:Zswim1 UTSW 2 164826027 missense probably benign 0.02
R0490:Zswim1 UTSW 2 164825283 missense possibly damaging 0.90
R1795:Zswim1 UTSW 2 164825400 missense probably benign
R4396:Zswim1 UTSW 2 164825449 missense probably damaging 1.00
R5191:Zswim1 UTSW 2 164826019 missense probably benign
R5290:Zswim1 UTSW 2 164825925 missense probably damaging 1.00
R6178:Zswim1 UTSW 2 164826052 splice site probably null
R6547:Zswim1 UTSW 2 164824796 start gained probably benign
R7247:Zswim1 UTSW 2 164825799 missense possibly damaging 0.95
R7442:Zswim1 UTSW 2 164825790 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTCTTCGGACAAAGCCAG -3'
(R):5'- ACTGTCTAGACTGGAGGCACAG -3'

Sequencing Primer
(F):5'- TTCGGACAAAGCCAGCCTCAG -3'
(R):5'- AGCATGTCGGGCTGGAGTAC -3'
Posted On2015-06-10