Incidental Mutation 'R7574:Gpr6'
ID586245
Institutional Source Beutler Lab
Gene Symbol Gpr6
Ensembl Gene ENSMUSG00000046922
Gene NameG protein-coupled receptor 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7574 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location41069977-41072285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41070656 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 310 (I310N)
Ref Sequence ENSEMBL: ENSMUSP00000057323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061796
AA Change: I310N

PolyPhen 2 Score 0.470 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000057323
Gene: ENSMUSG00000046922
AA Change: I310N

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
Pfam:7tm_1 90 330 2.5e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,942 V240A probably damaging Het
A930009A15Rik C T 10: 115,570,114 probably benign Het
Aarsd1 A G 11: 101,411,144 I201T probably damaging Het
Acaca T A 11: 84,261,588 Y854N probably benign Het
Adra2c T C 5: 35,280,415 L177P probably damaging Het
Akr1c12 A T 13: 4,279,310 I16N probably damaging Het
Aldh8a1 A T 10: 21,380,830 I47F possibly damaging Het
Birc6 A G 17: 74,579,884 I736V probably benign Het
Bmp2 A T 2: 133,560,897 M123L probably benign Het
C1ql1 T C 11: 102,945,986 Y159C probably damaging Het
Ccdc148 T C 2: 58,823,633 Y502C probably damaging Het
Ccdc155 A T 7: 45,204,611 H31Q possibly damaging Het
Cenpf A T 1: 189,658,667 N989K probably damaging Het
Ciz1 A G 2: 32,367,368 M142V probably benign Het
Cnot4 T C 6: 35,053,004 R320G possibly damaging Het
Cyth1 G T 11: 118,182,863 H215N probably damaging Het
Dapk1 G A 13: 60,761,173 G1200D probably damaging Het
Dhps A G 8: 85,072,552 Y103C probably damaging Het
Dnah1 T A 14: 31,319,908 E35D probably benign Het
Dnajb9 A T 12: 44,207,386 D79E probably damaging Het
Eif4a2 T C 16: 23,110,127 F164S probably benign Het
Enpp2 T C 15: 54,851,417 T595A probably benign Het
Exoc6b T A 6: 84,791,384 probably null Het
Fam171a1 T C 2: 3,220,354 S286P probably damaging Het
Fam35a C T 14: 34,237,466 S853N probably damaging Het
Fermt2 T A 14: 45,469,325 N338I probably damaging Het
Fhdc1 A G 3: 84,446,131 F596L probably benign Het
Fry T C 5: 150,380,894 V583A probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gdap1 T A 1: 17,161,441 F337I possibly damaging Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Gm14085 A T 2: 122,522,844 I502F not run Het
Gm35339 T A 15: 76,357,749 Y747* probably null Het
Gm8251 A T 1: 44,059,433 V835E possibly damaging Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Hexa T C 9: 59,563,984 V507A probably benign Het
Hmcn2 A T 2: 31,455,519 H4718L possibly damaging Het
Hrh4 T C 18: 13,021,913 F170L possibly damaging Het
Ica1 T C 6: 8,658,266 T284A probably benign Het
Itga5 T C 15: 103,350,449 N774S probably damaging Het
Itgb2 T C 10: 77,560,158 S556P probably benign Het
Kcnq4 A G 4: 120,711,368 F384L probably benign Het
Lama2 A T 10: 27,006,730 N2612K probably benign Het
Lnx1 T C 5: 74,685,438 E117G probably benign Het
Lrrc14b G T 13: 74,360,773 A505E probably damaging Het
Ly6g T C 15: 75,158,564 I77T probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrgpre C T 7: 143,781,350 V139M probably damaging Het
Muc4 T A 16: 32,753,411 S1096T probably benign Het
Myrfl G A 10: 116,831,525 R337* probably null Het
Ndufa4 C T 6: 11,906,093 V20I probably benign Het
Nf1 A G 11: 79,408,769 D241G probably null Het
Nid1 A G 13: 13,468,443 D322G probably benign Het
Nova1 A T 12: 46,700,761 D244E unknown Het
Olfr1022 A G 2: 85,869,006 K138R probably benign Het
Olfr1240 T C 2: 89,439,401 K293E possibly damaging Het
Olfr743 T A 14: 50,534,313 D300E probably benign Het
Padi2 C A 4: 140,949,337 N595K possibly damaging Het
Pag1 A G 3: 9,693,891 I389T probably damaging Het
Pcdh10 G T 3: 45,381,375 G708V possibly damaging Het
Pecam1 A G 11: 106,699,784 S55P probably damaging Het
Plin3 A T 17: 56,284,192 V196E possibly damaging Het
Plxdc1 A T 11: 97,956,490 L119Q possibly damaging Het
Pnliprp1 A T 19: 58,738,249 N346I probably damaging Het
Ppp1r27 A T 11: 120,551,030 Y8* probably null Het
Prg3 A T 2: 84,989,402 D80V probably damaging Het
Prmt5 T C 14: 54,507,890 N607D possibly damaging Het
Ptprs A G 17: 56,423,538 F1144L probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Rap1gds1 T A 3: 138,956,215 R427* probably null Het
Recql5 A G 11: 115,928,422 V106A probably benign Het
Resp18 T C 1: 75,273,971 T155A probably benign Het
Rfx6 A G 10: 51,681,818 D129G probably benign Het
Rsf1 T A 7: 97,661,167 I368K Het
Sema6a C G 18: 47,291,164 V226L probably damaging Het
Sf1 A G 19: 6,372,204 E220G probably damaging Het
Sidt1 T A 16: 44,259,485 Y602F probably damaging Het
Slc17a8 A G 10: 89,592,146 I273T probably benign Het
Slc41a1 A T 1: 131,839,151 I136F probably damaging Het
Snrpb T C 2: 130,177,019 I51V probably benign Het
Sprr2f T A 3: 92,365,947 C18S unknown Het
Stab1 T C 14: 31,154,665 N864S probably benign Het
Svil C A 18: 5,095,188 T1457K probably benign Het
Syt1 A T 10: 108,504,401 I352N probably damaging Het
Tas2r119 A G 15: 32,178,133 K282E probably damaging Het
Timeless T C 10: 128,244,669 F473S probably damaging Het
Tmc3 A G 7: 83,598,273 D192G probably damaging Het
Trmt1l T A 1: 151,440,840 I184N possibly damaging Het
Ttll6 G A 11: 96,134,875 V61M probably damaging Het
Ttn C T 2: 76,802,411 E14100K probably damaging Het
Txndc2 T A 17: 65,638,625 I186F possibly damaging Het
Ubr1 A T 2: 120,873,191 S1553T possibly damaging Het
Vmn1r208 T C 13: 22,772,535 N264S probably benign Het
Vmn1r87 T A 7: 13,131,686 M225L probably benign Het
Vmn2r101 T A 17: 19,611,637 C632S possibly damaging Het
Zfp474 T C 18: 52,639,189 S305P probably benign Het
Zfp59 A G 7: 27,853,438 N105S probably benign Het
Zfp804b T A 5: 6,772,301 Y254F possibly damaging Het
Other mutations in Gpr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Gpr6 APN 10 41070816 missense probably damaging 0.99
IGL01010:Gpr6 APN 10 41071151 missense probably benign
IGL01098:Gpr6 APN 10 41070743 missense probably damaging 1.00
IGL01323:Gpr6 APN 10 41071559 missense possibly damaging 0.96
R1153:Gpr6 UTSW 10 41070837 missense probably damaging 1.00
R1154:Gpr6 UTSW 10 41070837 missense probably damaging 1.00
R1622:Gpr6 UTSW 10 41071292 missense probably damaging 1.00
R1628:Gpr6 UTSW 10 41071548 missense possibly damaging 0.96
R1638:Gpr6 UTSW 10 41070534 missense probably benign 0.02
R1935:Gpr6 UTSW 10 41071481 missense probably benign 0.02
R1936:Gpr6 UTSW 10 41071481 missense probably benign 0.02
R2108:Gpr6 UTSW 10 41070653 missense possibly damaging 0.79
R2129:Gpr6 UTSW 10 41071172 missense possibly damaging 0.50
R4024:Gpr6 UTSW 10 41071268 missense probably damaging 1.00
R4237:Gpr6 UTSW 10 41070608 missense probably damaging 1.00
R4418:Gpr6 UTSW 10 41070608 missense probably damaging 1.00
R4703:Gpr6 UTSW 10 41071041 missense probably damaging 1.00
R4814:Gpr6 UTSW 10 41071262 missense possibly damaging 0.94
R6821:Gpr6 UTSW 10 41071008 missense probably benign 0.04
R7190:Gpr6 UTSW 10 41070960 missense probably damaging 1.00
R7573:Gpr6 UTSW 10 41070872 missense probably damaging 0.99
R7611:Gpr6 UTSW 10 41070879 missense probably benign 0.02
R8011:Gpr6 UTSW 10 41070915
Predicted Primers PCR Primer
(F):5'- TTGACGCTCACCAAAGGCTG -3'
(R):5'- ACTTGTACGTGCGCATCTGC -3'

Sequencing Primer
(F):5'- CCAAAGGCTGGCATGTTGG -3'
(R):5'- CATCTGCCAGGTGGTCTG -3'
Posted On2019-10-24