Incidental Mutation 'R4165:Rps3'
ID321691
Institutional Source Beutler Lab
Gene Symbol Rps3
Ensembl Gene ENSMUSG00000030744
Gene Nameribosomal protein S3
SynonymsD7Ertd795e
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R4165 (G1)
Quality Score182
Status Validated
Chromosome7
Chromosomal Location99477896-99483738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99483609 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 5 (I5V)
Ref Sequence ENSEMBL: ENSMUSP00000102713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032998] [ENSMUST00000107096] [ENSMUST00000208532]
Predicted Effect probably benign
Transcript: ENSMUST00000032998
AA Change: I5V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032998
Gene: ENSMUSG00000030744
AA Change: I5V

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083888
Predicted Effect probably benign
Transcript: ENSMUST00000107096
AA Change: I5V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102713
Gene: ENSMUSG00000030744
AA Change: I5V

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128725
Predicted Effect probably benign
Transcript: ENSMUST00000208532
AA Change: I5V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1454 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit, where it forms part of the domain where translation is initiated. The protein belongs to the S3P family of ribosomal proteins. Studies of the mouse and rat proteins have demonstrated that the protein has an extraribosomal role as an endonuclease involved in the repair of UV-induced DNA damage. The protein appears to be located in both the cytoplasm and nucleus but not in the nucleolus. Higher levels of expression of this gene in colon adenocarcinomas and adenomatous polyps compared to adjacent normal colonic mucosa have been observed. This gene is co-transcribed with the small nucleolar RNA genes U15A and U15B, which are located in its first and fifth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 I189V probably benign Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Prdm1 T A 10: 44,441,576 Y417F probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Snapc1 G T 12: 73,982,580 probably null Het
Sobp C T 10: 43,021,648 G647D probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Rps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rps3 APN 7 99479272 critical splice donor site probably null
R3710:Rps3 UTSW 7 99479419 missense probably benign 0.02
R3894:Rps3 UTSW 7 99479896 missense probably benign 0.07
R3895:Rps3 UTSW 7 99479896 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TGTTCGAGTCGGTCCAGAACTC -3'
(R):5'- AGGTTGCTAGGTTACACCCC -3'

Sequencing Primer
(F):5'- TCGGTCCAGAACTCGAGGAG -3'
(R):5'- CCCCTACGCCGTTTTAGAC -3'
Posted On2015-06-12